<?xml version="1.0"?>
<TEI xmlns="http://www.tei-c.org/ns/1.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.tei-c.org/ns/1.0 http://digital.lib.ecu.edu/tei/xsd/tei_P5.xsd">
  <teiHeader>
    <fileDesc>
      <titleStmt>
        <title>
        </title>
        <author>
        </author>
        <respStmt>
          <resp>Text encoded by</resp>
          <name>Digital Collections</name>
        </respStmt>
      </titleStmt>
      <publicationStmt>
        <distributor>East Carolina University. J. Y. Joyner Library</distributor>
        <address>
          <addrLine>Digital Collections</addrLine>
          <addrLine>Joyner Library, East Carolina University</addrLine>
          <addrLine>East Fifth Street, Greenville NC 27858-4353 USA</addrLine>
        </address>
        <date>2012</date>
      </publicationStmt>
      <sourceDesc>
        <bibl>
        </bibl>
      </sourceDesc>
    </fileDesc>
    <encodingDesc>
      <samplingDecl>
        <p>All quotation marks retained as data.</p>
        <p>All end-of-line hyphens have been removed, and the trailing part of a word has been joined to the preceding line.</p>
        <p>All smart quotes have been converted into straight quotes.</p>
      </samplingDecl>
      <classDecl>
        <taxonomy xml:id="LCSH">
          <bibl>Library of Congress Subject Headings</bibl>
        </taxonomy>
      </classDecl>
    </encodingDesc>
    <profileDesc>
      <creation>
        <date>
        </date>
      </creation>
      <langUsage xml:lang="en-US">
        <language ident="en-US" usage="100">English</language>
      </langUsage>
      <textClass>
        <keywords scheme="#LCSH">
          <list>
            <item>
            </item>
          </list>
        </keywords>
      </textClass>
    </profileDesc>
  </teiHeader>
  <text>
    <body>
      <div type="other">
        <p rend="align(centerbold)">[This text is machine generated and may contain errors.]</p>
        <pb facs="00087514_0001" />
        <p>WEATHER</p>
        <p>rr^TTTT^ TX TT X T TXTT^T^T Tl'AXIX</p>
        <p>TELEPHONE</p>
        <p>e9&amp;gt;</p>
        <p>Fair aad a UUle warmer le-niaht. Tuesday, increaafaig aloadl-Bcas and continued mild.</p>
        <p>THE DAILY REFLECTOR</p>
        <p>TRUTH IN PREFERENCE TO FICTION</p>
        <p>PLaza 2-6166</p>
        <p>All Departments</p>
        <p>79th Year</p>
        <p>No. 291</p>
        <p>MHIBHI 39 AMOCIATID PRM</p>
        <p>GREENVILLE, N. C. MONDAY AFTERNOON, DECEMBER 5. 1960</p>
        <p>12 Pas:es Today Price 5 Centg</p>
        <p>Broader School Insurance Policy Approve Today</p>
        <p>By PATRICIA MOORE Reflector Staff Writer</p>
        <p>An insurance program which will broaden coverage of Pitt County school buildings and lower rate of cost was approved by the Pitt County Board of Education this morning.</p>
        <p>Letters were mailed to all insurance agencies with coverage on Pitt County school properties as of Nov.. 15 regarding blanket policies of the County Board of Education. These agencies were asked to mquire if their agency could secure coverage with companies in Public and Institutional Property Form.</p>
        <p>The /ire, extended coverage, and malicious mischief and vandalism Insurance now used would be changed to a new form entitled Public and Institutional Property, PI Por No. 1, (April 1960) Fire EC and PI Form No. 3 (March 1960) Vandalism and Malicious Mischief, as recently released through the N-C. Rating and Inspection Bureau.</p>
        <p>Bancroft Moseley, local insurance man. appeared before the board at their meeting this morning to discuss the policy further. He originally discussed it with them at a meeting Nov. 14.</p>
        <p>Reduction* in rates were estimated at about 25 percent less on the lira coverage, 40 percent less on extended coverage and 60 percent less on vandalism and malicious mischief. These are e-Umated, anofficial reductions.</p>
        <p>In answer to queries from board members, M(Mieley said that schools and colleges (with exception of state colleges) are taking the new form of insurance cover</p>
        <p>age.</p>
        <p>Following approval of the new form of Insurance for county school properties, the board authorized D.H. Conley, superintendent of county schools, to increase valuations on some Pitt County school buildings. The increases probably will total about $395,000, Conley noted.</p>
        <p>However, with the reduction in rates, these increases actually would not increase the cost of the policy, but will extend the coverage under the flew policy, taking advantage of lower rates, members noted.</p>
        <p>The board decided not to participate in a replacement cost provisin at the present time.</p>
        <p>Student Reassignment</p>
        <p>About four students now attending the South Edgecombe School will be notifled that they have been reassigned to the Pitt County Schools about Christmastime. The students will be assigned to either Fountain or Facmville elementary schools.</p>
        <p>A report on the completion of the Pitt County garage and expenditures was presented to the board. Total cost of the garage, now two years old, is $61,639.96, which includes $16,500 for land, as well as cost of grading, paving, radio and supplies.</p>
        <p>The garage is located tm Third Street extension.</p>
        <p>In othw business, the board approved the hiring of t science teacher at Chicod School, to replace one who recently resigned. Reports from Supervisors Mrs. Edna Earle Baker, Arthur 8. Alford and F.D. Sledge were read by board members. __</p>
        <p>Sweeping Change In Defense Dept. Put To Kennedy</p>
        <p>PALM BEACH, Fla. (AP) -President-elect John F. Kennedy today got a report recommending sweeping Defense Department reorganization  including eHraina-tion of the civilian secretaries of Army, Navy and Air Force.</p>
        <p>The goal could be to givo the secretary of defense instantaiieous control in event of nuclear war.</p>
        <p>The report was submitted to Kennedy by Sen. Stuart Symington, D-Mo., head of a committee which the President-elect set up to plan streamlining of the vast Pentagon operation for the nu-elear^paee age.</p>
        <p>Symington told a news conference aftr conferring with Kennedy that in his opinion his committees recommendations would cut present military.;)ending by about 20 per cent or $8 billion annually. But he said this money likely would have to be plowed back for such things as new weapons development and an arms control program.</p>
        <p>While the Symington committee wouUl abolish the civilian secre-</p>
        <p>Suicide Ruling In Shotgui Death</p>
        <p>FARMVILU-Pitt County Co-rcmer E. W. Harvey ruled the death of Albert Norcutt Moseley, who died of a shotgun wound Saturday night, suicide,</p>
        <p>According to Harvey, Moseley, 45, shot himself at the rear of a service station at the intersection of Wilson St. and U.S. 258 about 8:30 p.m Saturday, with a .12 guage shotgun borrowed from the station.</p>
        <p>Harvey, who pointed out that Moseley was a truck driver and was separated from his wife, said no reason for the suicide could be found.</p>
        <p>The coroner reported that Moseley called his wifes home a short time before his death and talked with his daughter. Officers said he told his daughter that he was going to kill himself but did not tell her where he was calling from.</p>
        <p>Investigators said that he went to the service station, took the gun, then went to the lot^ at the Tear of the station, and shot him-self in the head. Harvey noted that no one saw Moseley take the gun and no one knew he was behind the station until they heard the blast and went to Investigate.</p>
        <p>Harvey said no inquest into the death will be held.</p>
        <p>hopping day left</p>
        <p>USE CHRISTMAS SEALS</p>
        <p>H0|TT6v</p>
        <p>taries of the Army, Navy and Air Force, those services would be retained as separate entities in the defense establishment.</p>
        <p>The plan of Symington, who was secretary of the Air Force in the Truman, administration, also would eliminate the undersecretaries and the assistant secretariesall civlliaaisof the three services.</p>
        <p>In aU, 15 civilian offices would be wip^ out in the three services. The committee also would abolish seven assistant secretaries of defense, bringing the grand total of cffices abolished to 22.</p>
        <p>Joblessness in some sections of the country was an issue in the presidential campaign, and Kennedy said he was naming his study group to fulfill a pledge made during his bid for election.</p>
        <p>The President-elect scheduled a mid-moming conference with Sen. Stuart Symington, D-Mo., who heads a committee Kennedy set up to map streamlining of the nations vast military establishment.</p>
        <p>Sources who asked not to be named said Kennedy has decided to name Udall, 40, to the $25,000-a-year interior post in the Cabinet.</p>
        <p>'These sources said the President-elects present plan is to announce selection of Udall, a member of the House Interior and Insular Affairs Committee, while in New York Wednesday. Udall, it is understood, has been asked to be on hand (w the announcement.</p>
        <p>Kennedy headquarters had said the President-elect will disclose his choice for another Cabinet post in New York Wednesday.</p>
        <p>Pierre Salinger. Kennedys press secretary, wouldnt specify the position to be filled, but he ruled out one Cabinet position secretary of state. An announcement on that may come later in the week.</p>
        <p>Kennedy and his daughter Caroline, 3, arrived in Palm Beach for the weekend Friday evening. Caroline and her governess plan to stay on for a few weeks. ^ Over the weekend, Kennedy p*cked the second member of his CabinetNorth Carolina Gov. Luther Hodges to be secretary of commerce. The President-elect earlier had named Gov. Abraham Rlblcoff of Connecticut as secretary of health, education and welfare.</p>
        <p>At the White House Tuesday Kennedy will meet for the first time since his election with President Eisenhower. They will discuss the problems of transfer from a Republican administration tr a Democratic regime.</p>
        <p>Typhoon Points Out To Open Sea</p>
        <p>TOKYO (AP)Typhoon Ophelia. apparently sparing Japan from its ll5-mlle center winds, swung back Into the uninhabited north Pacific today on a northeast course.</p>
        <p>The off-season typhoon, which killed two persons on Ullthi Atoll in the central Pacific, caused heavy snow and rainfall in Japan.</p>
        <p>Coed Killed</p>
        <p>EDITH RACHEL SPIVEY    ECC student</p>
        <p>Woman Is Charged In Fatal Crash</p>
        <p>WINDSOR  Manslaughter charges have been lodged against Mrs. Gertrude Small Boyce following a traffic accident in which an East Carolina Collie coed was killed yesterday afternoon.</p>
        <p>Fatally Injured in the .S. 17 crash was Edith Rachel Spivey, 20, of Hertford.</p>
        <p>Investigating highway patrolman Phill Bragg of Colerain said Mrs. Boyce has been released under $2,000 bond pending trial at the February term of Bertie County Superior Coiirt</p>
        <p>Ptl. Bragg said the accident happened yesterday afternoon at 4 o'clock 11 miles north of Windsor on U. S. 17. Miss Spivey was riding in a car driven by Miss Jen-nette Williams. Miss Shelby Overton was another passenger in the car, the patrolman stated. All three girls are from Hertford and all were riding In the front seat of the 1954 Plymouth. They were letuming to Greenville, the patrolman stated.</p>
        <p>Mrs. Boyce was driving on N.C. 46 and allegedly faHed- to stop for a stop sign at the intersection V/ith U.S. 17, according to Ptl. Bragg. Her vehicle ran in front ' the Williams car and the collision occurred, he reported.</p>
        <p>Miss Spivey was thrown from the Williams velle. She was taken to Chowan Hospital by ambulance but died enrbute. E)eath was due to head and chest Injuries, Bragg said.</p>
        <p>Miss Williams and Miss Overton, both ECC students, received minor injuries In the crash. Mrs. Boyce was shaken up but otherwise uninjured. Several children in her car were not injured, Bragg reported.  *</p>
        <p>Mrs. Bqycej age was given as 49 and her address was listed as Rt. 2, Edenton.</p>
        <p>Miss Spivey was a member of the State 4-H Honor Club. She attended the National 4-H Club Congress in Chicago, HI. as State Home Improvement Project winner. She had received the Perquimans County Horace Layden Award as the countys most outstanding 4-H Club member. In 1959, Miss Spivey servctl as counselor to the 4-H Club in Manteo. She was a member of the New Hope Methodist Church where she was active in local and district Methodist Youth Fellowship work.</p>
        <p>Miss Spivey was a contestant In the Miss Greenville contest last spring. She graduated from Perquimans County Kgh School and she was a member of the Rho Zeta Chapter of Chi Omega. Miss Spivey waa on the ECC annual staff, a member of the YWCA and the Rome Economics Club.</p>
        <p>Surviving arc her parents, Mr. end Mrs. Carson Spivey; a brother Carson, Jr. of the home and her maternal grandmother. Mrs. Sadie Whedbee Pogue of Rt. 3, Hertford.</p>
        <p>Robert G. Little Takes Over As</p>
        <p>Pitt Commissioners' Chairman</p>
        <p>By HENRY HOWARD Reflector Staff Writer</p>
        <p>Robert O. Little of Simpson took ever as chairman of the Pitt County Board of Commissioners today moments before Greenvilles Redevelopment Commission displayed its urban renewal project for the county body.</p>
        <p>Little was named chairman, succeeding J. Vance Perkins of Greenville, at the boards rcorgan-izational session. Perkins was selected vice chairman.</p>
        <p>And a new member joined the board today. Bruce Strickland of Bell Arthur, elected in the November general election, officially replaced retiring District III Commissioner Woodrow W. Wooten of Falkland.</p>
        <p>William Cochran, director of the local redevelopment project, presented a schematic drawing of the ccmunisslons plan, including possible relocation of the Pitt County courthouse.</p>
        <p>Cochran appeared today with Greenville attorney, M. E. Cavendish, chairman of the Redevelopment C(nmlsion.</p>
        <p>Cavendish pointed out to the county board, We want to acquaint you with the plan ... We v/ant you gentlemen to be in on the ground floor.</p>
        <p>The chairman stressed the proposal Is only tentative at this stage. We dont know for certain whether It will be completed or even begun.</p>
        <p>Cavendish told the commission-trs two-thirds of the projects cost would be financed with federal funds with the City of Greenville paying the remaining one-third.</p>
        <p>The boundaries of the area, he said are also tentative."</p>
        <p>Cochran displajred the schematic drawing of the proposed area to be redeveloped and explained the reason* for the proposed relocation of the courthouse.</p>
        <p>We recognize that you are cramped for space here," he said. He pointed out the. renewal pro</p>
        <p>ject provides an opportunity to; relocate if the county has such plans for the future.</p>
        <p>A very major key to the success of the overall project, Cochran said, is the solution of downtown parking pr(^lems. The present courthouse block, he pointed out, would probably be turned into a municipal parking crea.</p>
        <p>Cochran termed the current situation on the courthouse block a no mans land where people can do no shopping. He said the parking area would help link the old business district with the proposed renewal project.</p>
        <p>The director of the project said property appraisal Is scheduled to begin sometime soon after the first of the year. He mentioned possible relocation of the National Guard armory on the courthouse block and the local Post Office across Evans St. from the court-I'ouse.</p>
        <p>No action was taken on the matter by the commissioners. They expressed their appreciation for the presentation. Commissioner B. Alton Gardner said, We are glad weve seen it and well be thinking about it.</p>
        <p>Commission Director</p>
        <p>Before the board convened today, the commissioners were introduced to the new executive di-lector for the Pitt County Development Commission, Dr. C. Sylvester Green.</p>
        <p>Hired recently by the development body. Dr. Green is scheduled for a two-week visit in Pitt before moving his family to the county early in 1961 to assume his position.</p>
        <p>In routine action, the board accepted report* of various department heads and approved payment of a bill for $848.52 submitted by D. 8. Spain for his services and expenses during the general election. Spain, as in past elections, billed the county $700 (Continued on page twelve)</p>
        <p>UNC Salary Hikes</p>
        <p>T ermed Necessary</p>
        <p>RALEIGH (AP)  Trustee* of the Consolidated University of North Carolina were told today that higher salaries for facul^ members and administrative officials are a must if the university is to retain its best personnel.</p>
        <p>A trustees visiting committee said In a report that the university in the last decade has lost 427 faculty and top administrative people, including 90 professors, 107 associate professors and 216 assistant professors. The list also included three chancellors, three provosts and six deans.</p>
        <p>We must warn you, the committee declared, to be prepared to suffer further disastrous losses unless pnnnpt steps are taken to provide adequate and competitive administrative and faculty salaries.</p>
        <p>The visiting committee report came as Consolidated University President William C. Friday reported to the trustees on budget recommendations made by the State Board of Higher Education.</p>
        <p>Friday said the board has recommended only 27.8 per cent of what the university requested in Its B budget for the next biennium. He said this included 54.7 per cent of the amount requested for boosting faculty salaries, 27.4</p>
        <p>per cent of the request fw* library unprovements and nothing for new programs.</p>
        <p>Friday told the trustees that funds to increase faculty salaries are the top priority item in our B budgets and wiU stand first in our request to the legislature In 1961.</p>
        <p>His comments came after W. D. Carmichael Jr., university vice president, recited statistics ccn-paring faculty salaries with other institutions. He said the university had lost ground in the past year.</p>
        <p>Carmichael told the trustees that among 15 state universities which are members of the Association of American Universities, Niath Carolina ranks 12th in the average salary paid professOTs, 13th for associate professors and llUi for assistant professors and instructors.</p>
        <p>Carmichael said the money requested by the university f(xr faculty pay raises wiU not improve our overall average faculty salaries appreciably. but that it would put the university in a position where we can keep most of our 'tall polesour really distinguished faculty peopleand will provide enough increases in the salaries of key professorships to attract more distinction as vacancies occur in the faculties.</p>
        <p>I*?:.'</p>
        <p>ih</p>
        <p>AT REORGANlZATlONAL MEETING TODAY . . . are (left to rifht) new District 111 Commissioner Bruce Strickland, new Chairman Robert G. Little, and ont-going chairman and new Vice Chairman J. Vance Perkins.</p>
        <p>Textile Industry Hopeful Over Secretary Hodges</p>
        <p>RALEIGH (AP)  The International scene will absorb Luther Hodges -wkea he leaves offiet as North Carolina governor and goes to Washington as secretary of c(Hnmerce.</p>
        <p>Many congratulatory messages awaited Hodges on his return Saturday night from Palm Beach, Fla., where President-Elect Jtrtm P Kennedy announced Hodges appointment to the cabinet.</p>
        <p>Hodges. M-year-old former textile industrialist, has traveled around the world during his six years as Tar Heel chief executive.</p>
        <p>Based on his travels, he said Sunday, any contribution I can make along the lines of international trade will certainly tend to bettw our foreign relations situar tiOn. I expect to give a lot of time to this phase of the Job. Commenting on speculation that his appointment might affect the textile import situation, Hodg^ said, it is too early fw any&amp;lt;me to come to any definite conclusions on policies he will follow.</p>
        <p>We will, of ccHirse, operate under the broad policies laid down by President Kennedy, he continued. At the same time, Hodges said, We will do all we can to be realistic and fair to all groups. As a retired textile executive, Hodges would be expected to give sympathetic ear to troubles o( textile manufacturers.</p>
        <p>American texglle businessmen are looking to Hodges as a man who understanls their problems.</p>
        <p>Prize - Winning Floats Listed For Ayden Christmas Parade</p>
        <p>particularly the problem of textile Imports. Some foreign competitors view the appointment of Hodges with gloom.</p>
        <p>However, a Japanese embassy expert in Washington predicts Hodges will become a liberal trader once he takes office.</p>
        <p>Several things raised the hopes of the textile industry. For one, Hodges was in the business himself at one time, serving as vice president of what is now Fleld-crest Mills.</p>
        <p>AnoUier reason is that Hodges played a key role in persuading the Southern Governors Conference in September to adopt a resolution urging federal action in regulating foreign imports of textiles, oil products and some fish-ery items.</p>
        <p>S&amp;lt;xne textile men soted, too. that Kennedy committed himself during the campaign ncM; to let domestic industries be swamped by foreign imports.</p>
        <p>A Washington representative of Hong Kong business interests said he thought the Hodges appointment might mark the rise of protectionism for the U.S. textile industry.</p>
        <p>The American Cotton Manufacturers Institute says that in the last two years the United States has become a net importer of textiles. Previously, the United States had sold more textiles atxroad that it brought, the ACMI said.</p>
        <p>The ACMI also predicts a cyclical downturn for the American industry. The prediction was based on a market analysis which the ACMI said ahows inventories have been builS up, orders are falling off, prices are declining and employment decreasing In American mills.</p>
        <p>One oi the telegrams of congratulations to Hodges came from</p>
        <p>Frederick MucDer, present secretary of commerce.</p>
        <p>Hodges WiU leave offiee wfum Terry Sanford is inaugurated as governor Jkn. S. Hodges plans to go to Washington within the next week or 10 days- He said he would meet with Mueller to talk over transferring the department.</p>
        <p>He appointmmt is subject te confirmation by the Senate, a hurdle Hodges should clear with ease,</p>
        <p>Hodges is expected to take over his Washington job around Jan. 20. the inauguration dats tor Ken* nedy.</p>
        <p>The govenuHT had purchased a home in Chapel Hill, and an* nounced plans to settle dowa there. Hodiges said be would hava to talk things over with Mrs. Hodges in deciding what to do with the Chapel Hill bouse.</p>
        <p>Hodges has served six yean as governor since he stepped up from lieutenant governor on the death of Gov. WlUlam B. Umstead. He won a four year term in his owa right.</p>
        <p>Adlai To UN?</p>
        <p>NEW YORK (AP)  President-elect John F. Kennedy is prepared to offer Adlal E, Stevenson the post of anbas-sador to the United Nations, press reports said today.</p>
        <p>The reports were carried In the Daily News and the New York Times.</p>
        <p>The News, in a dispatch from Washington, said 'This woald bo in line with presioaa reports indicating that Kennedy had firmly decided that someone other than the two-time presidential nominee would be picked for secretary of state.</p>
        <p>Titan Missile Explodes Soon After Fueling</p>
        <p>VANDENBERG air FORCE BASE, Calif. (AP)The Air Force today studied the shattered ruins of a Titan intercontinental ballistic missile, trying to learn why it exploded shortly after fueling.</p>
        <p>Damage from the blast Saturday night was estimated at between $4 million and $6 million. and Air Force spokesman said. The missile Is destined for a major role as an ocean-epannlng nuclear weapon.</p>
        <p>The Air Force was unable to estimate how long the Titan program will be delayed by the explosion.</p>
        <p>This was the first explosion of a Titan at this base. ITO miles northwest of Los Angeles. Similar explosions have occurred at Cape Canaveral, Fla.</p>
        <p>The Air Force said the 97-foot long Titan was being lowered into its underground concrete silo after fueling when it exploded with a roar that shook windows 25 miles away.</p>
        <p>There were no Injuriescrews were in an underground building several hundred yards away.</p>
        <p>AYDEN - The Methodist Youth Fellowship of Ayden Methodist Church won the $100 first prize for the best float of Aydens annual Christmas parade, held Saturday afternoon.</p>
        <p>Following a religious theme, a large revolving globe with a Bible open to the Christmas story of I.uke, dominated the float.</p>
        <p>News Media Are Asked To Take 3-Day Holiday</p>
        <p>NEW ORLEANS. La. (AP) Mayor deLesseps S. Morrison has appealed to news media to take a 3-day holiday from on-the-scene .school Integration coverage, beginning today.</p>
        <p>The mayor said he thought demonstrators would not show up at two integrated schools if the press did not appear.</p>
        <p>Morrison suggested a press poolwhere one reporter and one photographer would cover the school scene and share coverage with all others. Another suggestion WW that police photographers supply all media with film and a report.</p>
        <p> In a letter to news media rep-regimtatives dated Friday, Morrison said the people who are demonstrating are principally the same ones. They number not over 200 persons, he said.</p>
        <p>Second prize of $60 went to the Jaycee float. Jay-C-Ettes cooperated in decorating the float, which featured a train with two cars on the back and toys inside the train.</p>
        <p>The Womans Club float took third place, a prize of $25.</p>
        <p>Observers commented that more thought went into the floats than e\er before this year and that practically every business partl-c pated in putting up prize money. The town of Ayden has the unique aistinction of preserving a noncommercial theme In their Christmas parades from year to year. The parade was sponsored by the Ayden Chamber of Commerce, V ith Warren Kinlaw as general chairman. Lee Nance is president.</p>
        <p>A good crowd turned out for the parade, which included about 24 units consisting of 11 floats and four bands. Prize winning floats are expected to appear in the Qrifton Christmas parade on Friday.</p>
        <p>Judges were Mr. and Mrs. Charles Edwards of Parmvllle, Mr. and Mrs. Burney Tucker of Win-tervllle and Mr. and Mrs. 8am Nelson of Orifton.</p>
        <p>Those serving on parade committees Included Corey Stokes, line up: Floyd Rowe, J. i Sum-rell, Jimmy Langston, J. R. Taylor, on Inviting Judges, preparing a judging stand, and decorations. Judges wives received corsages.</p>
        <p>F\&amp;gt;lIowlng the parades conclusion, Santa Claus returned to the middle of town and dispersed goodica to the children.</p>
        <p>AYDEN CHRISTMAS PARADE . .. this Jaycee and Jay-c-elte float econd priz8 Sea other photo page three. (Photos by Roy Hardee).</p>
        <p>won</p>
        <pb facs="00087514_0002" />
        <p>If</p>
        <p>/</p>
        <p>PAGE TWO</p>
        <p>liRp</p>
        <p>THE DAILY REFLECTOR. GREENVILLE, N. C</p>
        <p>Monday, Decembar 5, I960</p>
        <p>V/ith The Farm Women</p>
        <p>By MAIDRED MORRIS</p>
        <p>(Items this w'eek from Washington, Yancey, Cleveland. HertforcJ. Alnmance, and Scotland Counties. ' BELIEVES IN USING HOMEGROWN PRODUCrrSMrs. Kenneth Allen, Monticello Club, believes in encouraging the use of products grown by Washington County farmers. She tried out an od recipe used by her great RiRndmothei called peanut com bread, but no corn meal was used only ground peanute, eggs and</p>
        <p>Coffee Honors Bride-Ellect</p>
        <p>STOKESMiss Margaret Ann Wjiitehurst, bride-elect, was hon-cred at an informal coffee hour &amp;amp;.turday at the home of Mrs. L. S. Brown, grandmother of the brlde-lect</p>
        <p>Hostesses were Mr. Brown and Mrs. R. R. Alexander, great-aunt ot the honoree. Mias Whitehurst was presented a corsage of white chrysanthemums to compliment her rose velvet shMth dress.</p>
        <p>OuesU were greeted at the door hy the hostess^ and were Introduced to the receiving line composed of the honoree, her mother, Mrs. Clarence Whitehurst, Barbara Manning of Oreenvlt, and Betsy Alexander of Stokes.</p>
        <p>The home was decorated with dried flower arrangements. The dining nxxn table was covered with a white lace cloth. In the center wae an arrangemmt of white mums, snapdragons, and gremiery flanked crystal can-dtabra which held white candles.</p>
        <p>An assortment of cookies, nuts and sutdwlches was served with coffee. Among those assisting the hostesMs in serving were: Mrs. WllUam Crandell, Mrs. Herbert Brown and Mrs. Sam Brown of Stokes, aunts of the honoree. and Mrs. Jee Johnson of RobersonvlUe.</p>
        <p>The honoree was remembered  ^th gifts of silver and crystal in oer chosen patterns. Approximately 30 guts were present.</p>
        <p>sugar.</p>
        <p>Mrs. Prances Darden, home eco-nmnics agent, says Mrs. Allen served the peanut corn bread at her Home Demonstration Club meeting. The product proved so tasty that each club member asked for the recipe.</p>
        <p>CLUB GETS LEADERSHIP AWARDYtrcey County Home Demonstration Club members recently presented a gavel to Jacks Cheek Club for having shown outstanding leadership in various club activities.</p>
        <p>According to Miss June Street, home economics agent, the award v as based on demonstrations given by leaders; attendance at meetings; assisting with bloodmobile. chest X-ray clinic and United Fund; working with community development clubs; and sponsoring service projects such as furnishing lunches and clothing for needy school children.</p>
        <p>TURNS HOBBY INTO PROPTT-ABLE BUSINESSMrs. Forrest</p>
        <p>Crowder of Lattlmore, has made her hobby of making aprons turn into a profitable business. She styles them attractively but for practical purposes.</p>
        <p>Miss La Una Brashears, home economics agent in Cleveland County, says Mrs. Crowder has open house from Thanksgiving day until the Clu-istmas holidays so people can call and select aprons for gifts. Last year, she sold over 300 aprons.</p>
        <p>GOOD LIOHTINO FOR YOUR</p>
        <p>STUDY CENTERDo you provide projbcf lighting over youd childs study' area? The 4-H'ers in Hertford County have been studying rules for good lighting.</p>
        <p>According to Mrs. Jane Taylor, assistant home ecdnomics a^ent, the girls discussed the recommended type of light bulb, the vattage, the shape, size,, and color of the lamp shade, and the placement of the lamps.</p>
        <p>TIN CANS IN DEMAND IN ALAMANCECraft leaders are getting ready tox Christmas in Alamance County. Mrs. Richard Smith, Burlington, Rt. 1, conducted a workshop tn tin craft She Displayed Christmas trees, ornaments and bells as well as plaques and candleholders.</p>
        <p>Miss Katherine MlUsaps, home ecor.omics agent, says Mrs. Smith saves lids from cans varying In s^Ec from the smallest Juice cans to large No. 10 cans. In making plaques, she uses metal liquid detergent containers, coffee and shortening cans.</p>
        <p>4-H COOKINO SCHOOL  Plans have been made for 4-H cooking schools to be held in eeveral co-nmunities for first year 4-Hers taking the project Adventures In the Kitchen.**</p>
        <p>*T hope this will sUmulate interest in the m*oJect tot the girls as well as teach them correct practices to follow when preparing meals,* says Miss Barbara Jones, assistant home economics agent in Scotland Coupty.</p>
        <p>++ Calendar Of Events ++</p>
        <p>t MONDAY</p>
        <p>6:30 p.m.Rotary Club 6:40 p. m.Optlmisi Club meets at Silo Restaurant. 7:00 p.m.Lions Chib 7:30 p.m.Modem Woodmen of America meet at Woodmens Hall.</p>
        <p>7:30 p.m.Woodmen of the World, Slmjwon Lodge, meets at Simpson Community Bldg.</p>
        <p>8:00 p.m.Lodge No. 885, Loyal Order of Moose.</p>
        <p>TUESDAY</p>
        <p>10:00-12:00 NPlay School, Elm St. Park.</p>
        <p>10:00-5:00 p. m.Exhibition of paintings and graphics by Hahs Moller; pottery by Kenneth Beittel and Robert Berk-hart</p>
        <p>1:00 p.m,Mrs. Jarvis Alll-wUl be hostesses to the Sappho Book Club.</p>
        <p>3:00 p.m. The Delphian Book Club will meet with Mrs. Paul Scott. Mrs. John Parley will be the speaker.</p>
        <p>6:30 p.m.Greenville Music Club meets at Cinderella Restaurant.</p>
        <p>6:4 p.m.The OrcaavUle Musie Club will meet at Cin&amp;lt;*^ deretla Restaurant for dinnor. For reservation call Mrs. Be-^ gina Ruyle or JMrs. Chartes White Saturday.</p>
        <p>8:00 p.m^The Aries Bo&amp;lt;^ Club meets with Mrs. P. Coleman.</p>
        <p>8:00 p.m.Chapter No. 149. Order of Eastern Star.</p>
        <p>8:00 p.m.Woodmen oi the World meet at Redmens Hall.</p>
        <p>8:00 p.m.A. A.*s mit in their building on Farmville Hwy.</p>
        <p>WEDNESDAY</p>
        <p>ing and Mrs. J. L. Winstead.</p>
        <p>7:80 p.m.Dinner meeting of the Businen and Professional Wbmen's Club.</p>
        <p>7:00-9:30 p.m.The Sigma Nu Fraternity of ECC will sponsor a house-to-house canvass for groceries to help the Welfare Dept, during the &amp;lt;jhristmas season.</p>
        <p>8:00 p.m.The Jr. Womans Club will meet at the home of Mrs. James Qrulke, Overlook Dr.</p>
        <p>8:00 p.m.Thf American Legkm Auxiliary will meet at</p>
        <p>ttie home of W. J. Bundy, 1712 KnoUwood Drive.</p>
        <p>8:00 p. m.Elmhurst PTA</p>
        <p>will meet at the school.</p>
        <p>8:00 p.m.Chapter 1308</p>
        <p>of</p>
        <p>the Women of the Moose.</p>
        <p>8:30 p.m.Christmas Baaaar of the Greenville Business and Professional Women's Club at the Womans Club.</p>
        <p>FRIDAY</p>
        <p>10:00-12:00 NPlay School, Elm St. Park 10;00-5:00 p. m.Exhibition of paintings and graphics by Hans Moller; pottery by Kenneth Beittel and Robert Berk-</p>
        <p>10:00-5:00 p.m.Exhibition of paintixms and graphics by Hans Moller ; pottery by Kenneth Beittel and Robert Bcrk-hart</p>
        <p>THURSDAY</p>
        <p>10:00-5:00 p.m,Exhibition of paintings and graphics by Hans Moller; pottery by Kenneth Beittel and Robert Berk-hart.</p>
        <p>3:00 p.m.The Oeoige B. SingletaiT Chapter of the DC will meet with Mrs. J. L. Flem-</p>
        <p>Latest,Fashion Combined With Exact Science</p>
        <p>(g)</p>
        <p> 9TICIAN6* iMe</p>
        <p> Foiiits. OreenvQIe. N. G Alas IB Raleifk. Gnea^ bars sad ChaslottS.</p>
        <p>Finett Contact Lenuat Awailabla Ws WIN Remain Opea AH Day Wadnesdays A Saturdaya</p>
        <p>hart.</p>
        <p>,-6:30 p.m.Klwanis Club 8:30 pjn.Exdiange Club 7:30 pm.Redmen meet. 7:80 p.m.Troop No. 33 meets at Scout Hut, Eighth St. Christian Church.</p>
        <p>CHltpEN</p>
        <p>JANES SHOP</p>
        <p>Boys, Girls, Preteens Greenwilie, N. C*</p>
        <p>S-t-r-e-t-c-b-i-n-g Dollars</p>
        <p>RALEIGH  Numerous stores are featuring beef this weekend at special prtces.</p>
        <p>Mrs. Ruby P. Uzzle, consumer marketing specialist for tlm N.C. Agricultural Extension Service, says good buys will include round, sirloin, T-bone, Porterhouse and cube steaks, roasts and ground beef.</p>
        <p>Pork supplies have Increased with better prices on many cuts hams, picnic shoulders, pork chops and bacon. Canned hams remain about the same price.</p>
        <p>Most poultry products remain</p>
        <p>the 8igms Nu Fraternity of East Carolina College, this is a collection of groceries from the residents of Greenville to be given to the -Welfare Department to help provide more meaning to the Christmas season. Collection will take place on Wednesday night, December 7th, between 7:00 p.m. and 9:30 p.m. Residents are asked to leave their porch lights on if they wish to contribute. Any and all kinds of non-perishable food will be appreciated. All collectors will</p>
        <p>featured at many markets during the weekend. Turkeys continue in heavy supply and should hold at steady prices through December. Eggs hold their price levels with Grade A mediums advancing again.</p>
        <p>Apple supplies continue big with volume comparing favorably</p>
        <p>Birth</p>
        <p>White</p>
        <p>Bum to Mr. and Mrs. George identify themselves. For any addi- i Lee White of Route 3, GreenvlUe, tional information, call the Sigma!a daughter, Linda Kay, on Decem-Nu Fraternity House, PL 2-9583.) ber 4, 1960 in Pitt Memorial Hospital.</p>
        <p>with last year. SuppUea of Florida oranges are Increaaiiig. There is more fruit maturing and color is improving due to recent good weather. Good quality white and pink grapefruit supplies are plentiful. Look for* special buys in bagged fruit of S to 10 pound lots. Other fruits avidlable include grapes, pears, bananss, and dried fruits.</p>
        <p>Weekend ahoppers will find good offerings of cabbage, winter greens, and sweet potatoes. On</p>
        <p>the good buy list are onions, Irish potatoes, sweet potatoes, carrots, and squash. Lettuce and celery are better priced due to increased supplies reaching market.</p>
        <p>NO NEED TO COAX CHILDREN Thereli be no coaxing and cajoling the children to waah their faces and hands before holiday mealsif you provide them with gay white terrycloth mitts em-blamed with Santas face. These color-fast mitts double as hand puppets wha their soap-and-water duty is done!</p>
        <p>For the gift of hw lifetime, give her new, exciting Arsb-esqne eostsme jewelry imported frem Spain. Now on rfisplsy at Merle Norman Cosmetic Studio, 216 East Sth St.</p>
        <p>Christmas Meeting The American Legion Auxiliary will have its Christmas meeting Thursday at 8 p.m. at the home of Mrs. W. J. Bundy, 1712 KnoUwood Dr. Members are requested to bring a gift wrapped in Christmas paper.</p>
        <p>To Sponsor Supper Greenville White Shrine will seive an old-fashioned country ham luncheon with aU the trimmings in the Dining Room of the Masonic Temple from 11 am. to 1:30 p.m. Wednesday. Proceeds wUl go to the White Shrine Christmas Cheer Fund. Advance tickets and reservations may be obtained from Mrs. Marie Clark, PLasa 2-2929.</p>
        <p>^ A'lyi. &amp;lt;</p>
        <p>^  9</p>
        <p>As romantic, as glamorous as candlelight ... as festive as the season . . . and as up^date in fashion as~^ you are . . . beautiful dresses, destined to glimmer and glow at the most important parties of the year. We present a typically wide selection of elegant dresses in</p>
        <p>a gala mood . . miss or junior-</p>
        <p>styles to flatter you, sizes to fit you -in radiant fabrics, colors.</p>
        <p>Sizes for Juniors  9 to 15 Sizes for Misses  8 to 42</p>
        <p>24.95 up</p>
        <p>COME TO THE PARTY ... OUR BIG CHRISTMAS DRESS PARTY, YOULL SEE DRESSES THAT WU.L BE THE LIFE OF THE PARTY.</p>
        <p> French Room</p>
        <p> Second Floor</p>
        <p>Blount ~ Harvey</p>
        <p>"EASTERN CAROLINAS SHOPPING CENTER</p>
        <pb facs="00087514_0003" />
        <p>Monday Deceml&amp;gt;er S, 1960</p>
        <p>HHE DAILY REnJECTOR. CREENVILLE. N. C</p>
        <p>RACE THREE</p>
        <p>Greenville Elks Hold Memorial. Service For Departed Members</p>
        <p>Today we meet to let the world know that an Elk is never ior-Koten,* J. Con Lanier told Elks end guei^ts at Memorial services for departed Elks yesterday.</p>
        <p>We come not to bury them out tt recoil their good deeds which win live forever in our*?|iearU, he declared,  il.is ftttirig and prop-^ er ihA we awChcB shiuld gather , here to honor their Memory.,</p>
        <p>I Exalted Ruler W,.E. Watson was In charge of the seivices. Other F)ks participating'* were Thomas J Snowden, Jake Dixon, Charles King, J. G. Proctor, John Collins end Vt^ G. Norman.</p>
        <p>A quartet from the Bai-toer Shop group .sang several numbers with Frank Hill singing the Lords Prayer.</p>
        <p>Secretary Norman read the list of departed Elks toothers. They are: N. O, Warren, A Barrett, J. B. Lane, Jr., John Flanagan, * I.-Wv Nelherland, L.B. Garris H Dali'Laughlnghouse, C. B. Row-left, Jr.* Charles P. Maiming, ^ Felix Scheller, Oec C. Jones. C. L. Russ, Clem Garner, Bruce O, Baker.</p>
        <p>^ M. R. Long, Howard Sumrell, E. E Porbes, Tommy Sellers, I. S.</p>
        <p> f------</p>
        <p>Pieming, James 8, Picklen, P. T. Anthony, Robert L, Mouney, A. O. ladlock Guy V, Smith. B. C. Satterfield, W. G Scott. W. B. Haymes, E. C, WUkerson, Perry King, B. L Gardner, J. M. Barrett, Pred J. Porbes, Jr.. Dallas C. Clark, W. H. Woolard. E. M. Butler, Chester Walsh, O. L. Joyner, W. W. Lee, Jack W Barrett. J. R. Newell</p>
        <p>iGraveside Rites For ilrfant Son Today</p>
        <p>Graveside services for James Walter Williamson, infant son of Mr and Mrs, Walter R. Williamson of Route 3, Washington! were held at the Rober.sonvUle Cemetery Monday afternoon at three oclock.'</p>
        <p>Surviving are his parents; his grandparents, Mr. and Mrs. John Butts of Route 1, Fountain; and] his great grandmother, Mrs Mandy Williamson of Rt. 1, Fountain.</p>
        <p>Adultery Is grounds for divorce in all 50 states and the District of Columbia.</p>
        <p>AYDEN CHRISTMAS PARADESent tosses gOOdles to the kids following Aydens Christmas parade. Only non-commercial floats were entered in the parade which brought Santa to Ayden and opened the Christmas seajson. A float entered by the Methodist Youth Fellowship of the Ayden Methodist Church won first prlie. (Photo by Roy Hardee)</p>
        <p>ELKS MEMORIAL SERVICE . . . Exalted Ruler Watson Speaker Lanier Chaplain Dixon.</p>
        <p>Last Rites Set For Dr. Charles Riddick</p>
        <p>AYDENDr. Charles Roberts Riddick D.D.S., died at the home of his -on, William L. Riddick in Glen-Bumie. Maryland, early Sunday morning.</p>
        <p>Dr. Riddick had been In declining health for some-time.</p>
        <p>Funeial servlcas will be held Wednesday at 11:00 a.m. at the Britt Funeral Home conducted by the Rev. Louis Aliens, pastor of the Ayden Methodist Church i Burial will follow In the Ayden | Cemetery.  &amp;lt; j</p>
        <p>Dr. Riddick was bom in Oates-vllle. Gates County He attended! the Or tesville schools and Horner i Military Academy, and "was grad- , uated from Trinity College. He attended Baltimore Dental College.</p>
        <p>He first practiced in Elisabeth City. In 1907, Dr. Riddick located in Ayden and practiced until 1948, when he retired following a heart attack.</p>
        <p>The Riddicks moved to Glen-Burney, Maryland in 1959 to make their home with their son.</p>
        <p>.Dr. Riddick was a member of the Ayden Methodist Church and at one time served oh the board of Stewards. He was a charter member of Ayden Rotary Club, former member of the board of directors i ol the First National Bank of! Ayden.  j</p>
        <p>Surviving are his wife, the form-1 er Gay Wood.son, of Ashland, Va.,! one son, William L. Riddick of Glen Burney, Maryland.</p>
        <p>The largest number ^of tropical led in the culf of Mexico-Atlantia disturbances (hurricanes) record-'Ocean area in one season was 11;</p>
        <p>Why Lautores Diamonds Are Cheaper</p>
        <p>L We have a complete Diamond Grading Laboratory, en abllng us to grade loose, unset diamonds.</p>
        <p>2. We buy all our diamond.^ directly from the diamond cutter. 'Thi.s eliminates the wholesaler and broker. Actually. our prices compare with the wholesale prices ot wholesale and discount houses.</p>
        <p>3. We buy mountings direct from the manufacturer ana set our diamonds In onr store.</p>
        <p>4. All our diamonds and precious stones are bought and graded by a Certified Gemologlst.</p>
        <p>dCaidwuiA /u). ^WJtcJL&amp;amp;</p>
        <p>DIAMOND 8PECIAIJSTS</p>
        <p>fCrrttfltb OeaolagtgTl</p>
        <p>tlCISTUEB JEflUl</p>
        <p>illlttti tl|</p>
        <p>Traffic Toll</p>
        <p>RALEIGH (AP)  The Motor Vehicles Departments report of highway deaths and injuries for the period from 6 p.m. Friday to 10 a.m. today:</p>
        <p>Killed ..................... 10</p>
        <p>Bijured (rural) ........... 116</p>
        <p>Kled this year ............ 1.094</p>
        <p>Killed to date last year ... 1,076 Injured to Oct. 1 this year 19, Injured to Oct. 1 last year 17,678</p>
        <p>CLASS FOR ADULTS</p>
        <p>GRIMESLANDA class on Attractive Meals for Special Occasions will be given in the Grimesland Schol Home Economics Department Wednesday at 3:30 p.m.</p>
        <p>Mrs. Lucille Mayo, home economics teacher In the schol, announced this first class for adults. The public Is invited to attend.</p>
        <p>5fof3c</p>
        <p>yifWf iisF</p>
        <p>JANES SHOP</p>
        <p>Boya GirU Pretecns Greanvillo N. C*</p>
        <p>NOW YOU CAN FIND</p>
        <p>THAT FAIL OR WINTER COAT, SUIT, DRESS AND SKIRT</p>
        <p>OF YOUR DREAMS</p>
        <p>NOW</p>
        <p>AT BIG</p>
        <p>SAVINGS...</p>
        <p>C. Heber Forbes</p>
        <p>DOUBU WOVEN NYION ^ CUSSK SUPON GLOVES ^</p>
        <p>1.00-r  ^</p>
        <p>Finiihlng touch to any eof-Itifn*. Supar-fine, bulk-free teamt. Quick-dry. Sizes</p>
        <p>ROMANTK UCES! PIRMANINT MiATSi PAMKR HER WITH lUXURY HYLOM SUPS</p>
        <p>Ours excluilvefyi No-Iren nylon frfcot, very-new nylon aatlni. Bodket of lace, embroidered sheer over nylon. Pluffer-pleoted hems, othori with deep lace-occented Rouncei. Six luxurlout atylet te chooto from, ail that second-akin fit that belonHs to Hetreaa olone. Chrittmoa white or bridal Ivory. Misses* sixes 32 to 40.</p>
        <p>Give Her Melnu Irond Nyten Trket Irlefa te Mfltdi IxecHy. I00</p>
        <p>FASHION COLORSI NYIOII SninCH STtMG 6L0VIS</p>
        <p>trbn-the-trae gift hex</p>
        <p>Interesting pebble stitch, iIhih cuff. Full-fashioned for belNff fit. One size fita ail honda .</p>
        <pb facs="00087514_0004" />
        <p>PAGE FOURTHE DAILY REFLECTOR, GREENVILLE. N. C</p>
        <p>Monday, Deceml&amp;gt;er 8. 1960</p>
        <p>Monday. December 5, 1960</p>
        <p>Stealing His Stirff</p>
        <p>Kennedy Made An Excellent Choice</p>
        <p>The appointment of Gov. Hodges as Secretary of Commerce in the Kennedy Cabinet reflects again the excellent choice of the president-elect in securing the best available talent for specialized top jobs in his administration.</p>
        <p>Gov. Hodges brilliant record in the fields of industry and government bespeak his outstanding qualifications for the post to which Kennedy has appointed him.</p>
        <p>While the appointment of Hodges as Secretary of Commerce did not come as a surprise, there would have been bitter disappointment in North Carolina and elsew^here too wed guessif the president-elect had passed over Hodges in filling this important Cabinet post.</p>
        <p>During the seven years he has served as governor of North Carolina, Luther H. Hodges has demonstrated unusual ability in administering he affairs of the state. Particularly has he demonstrated his capacity for leading the state to new and higher economic plateaus through developing the states capacity for industry. To the affairs of government he has applied the objective business viewpoint that has resulted in greater efficiency in our state governments operation. To one</p>
        <p>Complaints Get</p>
        <p>Some Attention</p>
        <p>By LYNN NISBET</p>
        <p>IfATT. BOX  the most interesting experience of a newspaper man is his daily visit to the mail box or to the pile of mall which someone has deposited on his desk. Despite long schooling against being surprised at anything the mail man might bring, there Is almost always an exhilirating surprise and one of the chief surprises is when the mail contains nothing of unusual interest.</p>
        <p>There are a dozen or more newspapers. All of them of monotonous similar format, and many Identical headlinesand yet each with an individuality challenging comparison with all the other sheets. There are the handouts from public relations men in government and private industry, extolling the virtues of particular brands of merchandise or political idele^: and certainly one or more requests for charitable donations. Hasty pawing through the pUe sometimes discovers that highly appreciated personal letterwished for but not quite expected that particular day.</p>
        <p>When the handouts are checked and generally consigned to the wastebasket; the donation requests handled in Uke manner; the personal letters read and enjoyed; the newspapers pushed aside for review later-along with the "please remit suggestionsthi attention is given to the gripe letters, mostly anonymous.</p>
        <p>Some* of these are original complaints from people who have been overcharged on water or tax bills, or unjustly (??&amp;gt; arrested for traffic violations, or otlmwdse discriminated against by law enforcement officers. Some of them merely enclose clippings of letters to the editor w newspaper comment about the incidents. And most of them convey the suggestion that there ought to be a law against enforcing laws already on the books.</p>
        <p>In his capacity as newspaper man and as president of the Travel Council of North Carolina your reporter gets a great many letters complaining about the treatment of folks traveling in the state.</p>
        <p>CONSIDERATION  Many of these gripes are so obviously absurd they are consigned to the wastclMtket forthwith. Some indicate need for investigation. iJka the complaints of out of state motorists that th^ had been suckered into gambling fames. Result of these complaints was that two or three joints were padlocked for the protection of other visitors.</p>
        <p>Then there was the gripe by an out of state woman motorist that she had been singled out of a line of fast moving traffic.</p>
        <p>arrested for speeding by a highway patrolman, and discourteously treated in a local court.</p>
        <p>That same day came word that -a North Carolina citizen was thoroughly ,^gusted with the unsanitary conditions In a roadside restaurant and demanded that tile A grade card be removed.</p>
        <p>Originals of these complaints went to responsible State agencies, and they investigated. It was mere coincidence that reports of these investigations also came to your reporters</p>
        <p>desk on the same day about a week later.</p>
        <p>The speeding lady was not stopped by a State highway patrolman but by a local city traffic cop. Evidence is she was clearly violating the law, and that she shared responsibility for discourtesy with the officers.</p>
        <p>The complaint-about roadside restaurant was re - checked by the State Health Department sanitarian, not just as routine checking but actually looking for trouble. He found less than perfect conditions but came up with a score of 91and a new A grade card for display.</p>
        <p>HELPFUL  The moral, if any, in these littie stories is that complaints and gripes about mistreatment of travelers along North Carolinas hlgh*vays are helpful, and aid in bringing about remedial action for bad conditions, if they are found to exist.</p>
        <p>In most Instances the re-sponsibile agencies are appreciative of the tips which disclose unsavory practices. The alleged victims of discrimination and malpractice are no more anxious than State officials to eliminate cause for complaint.</p>
        <p>Quite naturally the law enforcement officers, the careful and courteous business people who serve travelers, and the folks in both State and private positions who are seeking to promote travel bi^iness, do not hke the complaints. Unfortunately, they are forced to admit that some of the gripes are justified. The big job is to remove any cause for honest complaint, by running downsometimes at great effort and expenseevery one of the gripes, to determine if it has factual basis.</p>
        <p>North Carolina has an enviable record for courtesy and efficiency in law enforcement. The record is not perfect. And that reminds of the first time your reporter was ever in an airplane. He flew from Charlotte to Raleigh with Roy Rowe of Burgaw some 20 years or more ago, in a two-seat plane. On the instrument board had been attached a little brass plaque with these words- Almost right aint good enough.</p>
        <p>The Daily Reflector</p>
        <p>INCORPORATED</p>
        <p>Published Every Afternoon Except Sunday Established 1882 DAVro JULIAN WHICHARD, Publisher</p>
        <p>Entered at Post Office, Greenville, N C., as second class maC matter.</p>
        <p>SUBSCRIPTION RATES By Carrier (In Town)  Week  30c</p>
        <p>By Carrier fMotor Route)  Week  35c</p>
        <p>BY MAIL, Payable In Advance</p>
        <p>Oreetivllle Post Office. Pitt County, Robersonvllle, Vanceboro, Washington and Chooowlnlty</p>
        <p>Three Month ........................... $ 8.7S</p>
        <p>Six Months .............................. 7.00</p>
        <p>One Year ............... .............. 13 00</p>
        <p>North Carolina (other than listed above)</p>
        <p>Three Months  ......  $4.00</p>
        <p>Six Months...........  7  SO</p>
        <p>One Year .   14  00</p>
        <p>All Other Outside North Carolina</p>
        <p>Three Months............................ $ 4 28</p>
        <p>Six Months .....   8  00</p>
        <p>One Year ............................... 15  00</p>
        <p>MEIVIBER ASSOCIATED PRESS ^ rh# Associated Press Is exclusively entitled to use for publication all news dlsatchcs credited to It or not otherwi.se credited to thla paper and also the local news published herein All rights of publication of special dispatches here are also reserved.</p>
        <p>NATIONAL ADVERTISING REPRESENTATIVES Thomas F. Clark Co., Inc New York, Chicago, Atlanta. Member Audit Bureau of Circulation</p>
        <p>AU advertising copy must be received at least one day before publication date.</p>
        <p>of the major problems of the state^that of low per capita income and the lack of opportunities for employment in manufacturinghe formulated and carried out a positive, farsighted program that has brought phenomenal results during his administration and which will continue to enhance North Carolinas economy in the years to come.</p>
        <p>Gov. Hodges, from his backfrround, understands the problems of business and industry, and at the same time he understands the problems of areas which find themselves without sufficient economic momentum to adequately provide for its people. He has demonstrated vividly his ability to approach and analyze these problems and to formulate a realistic and positive program to overcome such problems. This ability which Gov. Hodges will carry to his post as Secretary of Commerce will prove a distinct asset to the Kennedy aciministra-tion and to the nation in the years ahead.</p>
        <p>From North Carolinas standpoint, the fact that Gov. Hodges holds an important post in the national administration will be a distinct advantage. It places Gov. Hodges in a position which he will be able to continue to be of important service to his own state while he serves the nation in one of ita top appointive offices.</p>
        <p>Instead of retiring from public life when his term as governor expires next January, Gov. Hodges unusual talents will continue to work in a still higher position for the betterment of the nation as well as for the betterment of his own state.  ^</p>
        <p>The appointment of Gov. Hodges as Secretary of Commerce is another recognition of his abilities and achievement which reflects credit not only upon the man himself, but upon North Carolina as well.</p>
        <p>Fitting Tribute To A</p>
        <p>Busy Greenville Lady</p>
        <p>iraae</p>
        <p>Views</p>
        <p>BABSON DISCUSSES CUBA By ROGER BABSON ' BABSON PARK,  Mass.The Cuban situation has reached a point whCTe it is affecting certain investments. Therefore, I feel that my readers are due an Impartial summary of the situation. I have always watched Cuba critically as it Is so close to Florida, where I have spent over thirty winters.</p>
        <p>INFLUENCE OF THE CATHOLK CHURCH</p>
        <p>I feel that the Cuban situation will come out satisfactorily due to the influence o!f tiie Catholic Church. The Cuban people, with their Spanish blood, are emotional and enjoy political and physical fights. They, however, are deeply R&amp;lt;mian Catholic in faith. Hence, there is a church safeguard which does not exist in Russia (M* in many of her satellites.</p>
        <p>The Communit Government in Russia has been brutal to the Christian church, due largely to its inheritance of the former Czarist domination which controlled and worked through the orthodox Church. The situation in Cuba, therefore, is entirely different fnrni the situation in Russia and its satellites.</p>
        <p>IMPORTANCE OF .</p>
        <p>MARKETABIUTY</p>
        <p>Mrs. J. H. B. Moores selection as this years recipient of the Greenville Exchange Clubs Book of Golden Deeds is indeed a fitting tribute to this fine lady who over a period of years has offered outstanding civic leadership and yeoman service in many fields for the betterment of Greenville.</p>
        <p>To enumerate Mrs. Moores civic activities in behalf of a better Greenville would be impossible in this space. Certainly important among them is the fact that through some 30 years she has been the moving force behind the building of a public art gallery here that has been culminated in the existance now of the Greenville Art Center. Her service to the Womens Club of Greenvillewhich included 16 years as its presidentwas acknowledged by members of that organization when they named her Honorary Life President.</p>
        <p>In many fields of endeavor, Mrs. Moore has continually been in the forefront of activity. On many occasions the leadership she has afforded in community life has led to many successful undertakings. As much as anything else, however, her service to this community has been marked by the fact she has not stood back to wait for others to accept the menial tasks, the details of hard work that spelled the difference between success and failure in an undertaking. She has not only been a leader, but at the same time a tireless worker at any task which she felt would be of benefit to this community and its people.</p>
        <p>We congratulate Mrs. Moore upon this honor which she so richly deserves, and we likewise congratulate the Greenville Exchange Club for its excellent selection in awarding its Book of Golden Deeds this</p>
        <p>By GEORGE SOKOLSKY</p>
        <p>3obby Kennedy Qualifies</p>
        <p>Copyright. 1^, King Features Syndicate, Inc.</p>
        <p>When it was suggested that Robert F. Kmnedy might be appointed Attorney General, there was hardly any objection on the grounds of nepotism. After all, the younger Kennedy had made his own career first as the counsel for the Democrats on the McCarthy Committee and more recently as chief counsel of the Senate Select Committee on , Improper Activities in the Labor or Management Field. Better known as the McClellan Com</p>
        <p>mittee, it exposed labor union corruption in several areas and showed the combination of unions and management in some rackets.</p>
        <p>The Kennedys, John, who was a member of the McClellan Committee, and Robert, its chief counsel, were accused of safeguarding Walter Reuther but when Reuther finally appeared for a hearing, the Republican members of the committee either lacked the material or the courage to proceed against him.</p>
        <p>If a man writes a book, it</p>
        <p>Other Editors Saying .. Of Men And Institutions</p>
        <p>(Greensboro Dally News) Robert Lee Humber, like Albert Coates, is an authentic genius. Without his single-mindedness, his hard-driving purpose, there would have been no State Art Museum in North Carolina.</p>
        <p>year.</p>
        <p>..win Factors In</p>
        <p>'business Trenc.</p>
        <p>By RALPH ROBEY</p>
        <p>Two items are crucial in the determination o the business trend. These are Inventories and business investment in plant and equipment. They may move together, or in opposite directions. This means that they may augment each other, or tend to offset each other. But there is only one phase of their importance.</p>
        <p>On inventories the only figures we have are historical. That is they refer to what already has happened. Of course predictions may be made, but they are fraught with danger. And errors in such predictions may be enormous, because changes in inventories may amount to twenty billion dollars a year. In the first quarter of this year, for example, inventories were being accumulated at an annual rate of over $11 billion. Since then there has been a continuous decline, and no one can know how much longer this drop will last.</p>
        <p>Such a movement of Inventories has a direct affect upon gross national product. It also has* a curtailing influence upon production, employment, consumption, and almost every other segment of our economic system. This has been perhaps the most important single factor in our business trend this year.</p>
        <p>On business investment in plant and equipment we have historical figures, but we also have predictions that have proved to be amazingly accurate. There are two sets of such figures. One is official, the other Ls private. The official series is compiled by the Department of Commerce and the Securities and Exchange Commission from data submitted by various individual companies. The private series is that of McGraw-Hill and is based upon replies to a questionnaire. The two differ in both coverage and details, but the totals always are relatively close.</p>
        <p>The latest government survey was based upon reports made In late July and August. The projections were carried only to the end of this year. They show the same total$36,9 billionfor both the third and fourth quarters.</p>
        <p>The McGraw-Hill survey has just been published. It covers the rest of this year and also 1961. The figures are both surprising and encouraging They show an anticipated decline for next year of only 3 per cent, to</p>
        <p>$35 billion. This 8 per cent applies both to manufacturing alone, and for all business together.</p>
        <p>The largest drop in proposed manufacturing investment is textiles21 per cent. The largest increase is  electrical machinery 10 per cent. In the non-manufacturing field railroads lead the list in declines24 per cent, and electric and gas utilities plan the greatest increase4 per cent.</p>
        <p>The projection is surprising f(W several reasons: the widespread talk of a recession over most of 1961: the unused capacity at present in all of our major industries, which in some instances amounts to between 40 and 50 per cent; the marked squeeze on profits in almost every field; and the difficulty, or impossibility, of raising prices.</p>
        <p>All of these considerations, one would assume, should curtail business Investment in plant and equipment -r curtail it by much more than a mere 3 per cent. Obviously other factors are even more important in the minds of business management. Among these probably the most significant are the desire to increase efficiency by more modem machinery, the Introduction of new products, the knowledge that a business can not simply stand still, and a genuinely optimistic long-term confidence in the future of our economic system</p>
        <p>If the McGraw-Hill proJection.s prove true, business investment in plant and equipment will be at least a sustaining fource throughout 1961.</p>
        <p>Dr. Humber believes in the Impossible. If his mission required the bartering of votes in the General General Assembly, if he occasionally ran roughshod over somebodys sensibilities, if he failed as an in-stltutionalizer (and as a paper-shuffler), so then he was, like other men, less tiian perfect.</p>
        <p>But any lesser zeal for his cause would have been fatal. Any lesser zeal would never have sold tiie Kress Foundation on a magnificent donation of art to North Carolina. Any lesser zeal would never have sold Gov. Gregg Cherry and the General Assembly of a decade ago on that astounding appropriation of $1,000,000 for an art museum.</p>
        <p>And for these things the State of North Carolina must remain deeply in the debt of Robert Lee Humber.</p>
        <p>But the institution he largely created (and others, of course, including Mrs. Kate Pendleton Arrington must be given credit too)this institution is another matter. It needs the soothing hand of a good institutionalizer. Perhaps Dr. Justus Bier, the new director. Is that man. If so. North Carolina will rejoice.</p>
        <p>The institution also needs reorganization. It needs to be placed under the orderly processes of goverpment In North Carolina, and while intelligent Tar Heels will differ on how that may be done, we favor a board composed o a majority of members appointed (on a staggered basis) by the Governor and a minority appointed</p>
        <p>by the State Art Society.</p>
        <p>Such organization, as Dr. Clarence Poe notes, works successfully for the State Board of Health. A majority of its members are appointed by the Governor, a minority by the N. C. Medical Society.</p>
        <p>At present the State Art Society Board (with four cx-officio members four appointed by the Governor and eight elected by the society) runs the State Art Museum.</p>
        <p>Art is not so distinctive that it cannot be entrusted to the good judgment of the Governor, with limitations on his power to dominate the board through staggered terms. Certainly those who know art roust continue as the backbone of museum management. A Tar Heel Governor would be foolish to pay off political obligations by placing individuals with no interest in art, and no understanding, on such a board. If North Carolina ever succumbs to the demagogue, more than an art museum will be in jeopardy. We must rely on good Tar Heel common sense to allow such a tragedy.</p>
        <p>In the meantime the enormous creative talent of Robert Lee Humber should not be lost to the state. He must continue his splendid campaign to lift the vision of North Carolina- That can be done within the new framework.</p>
        <p>North Carolina has few giants of creative talent in our time. In this half century you' may count them on your hand  Thomas Wolfe, Paul Green, Frank Graham. Albert Coates, Robert Lee Humber.</p>
        <p>Few, if any, of these men were good Institutionalizers. But their fame lies elsewhere. They produced what otiier lesser men could not produce. We need their considerable talent as much as we need the institutionalizers.</p>
        <p>is often possible to discern his qualifications. I therefore sat me down of a week-end to read Robert Kennedys, The Enemy Within, to discover what Robert Kennedy would do were he appointed Attorney General. I knew that when James P McGranery, President 'Trumans Attorney General, finished his terra, he left behind him a large number of incompleted cases of rac-'keteers in many fields, including labor and small business, for his successor to process. It is possible that had all these cases been adequately processed, Apalachlo would not have taken place.</p>
        <p>In fact, Robert Kennedy makes the point in his book that in a number* of instances, The lack of action by the Department of Justice is disappointing. It has lost some of the cases through incompetencer SeiiStor McClellan, who was a witness in the perjury trial of James Cross, president of the Bakers Union, made no secret of the fact that he was highly critical of the way the Government attorneys presented that case </p>
        <p>Cuba is rich In soil, rainfall, siuishine,  and warm temperatures. It could be the garden-spot of the Americas; but It has been cursed by wretched and unjust government. Caitro thinks It necessary only to nationalize the farms, businesses, banks, and the few manufacturing establishments; he j^ems to give no thought to marketing. Cubas wonderful productive conditions are of no use if her products cannot be marketed. Cuba-s natural market is the United States (which Castro is abusing and</p>
        <p>doing his bestto aUettMe). This )le i</p>
        <p>In the case against James Hoffa for wiretapping, Kennedy had arranged for one of its assistants, Carmine Bellino, to give the prosecuting attorney a detailed chronology of Hoffas whereabouts for every day over a period of about three months in 1953. So the chief witness for the prosecution said that he had met Hoffa in Detroit on July 10. 1953. BelUnos memo showed that on that date Hoffa was in Seattle, Washington. I quote now from Robert Kennedy:</p>
        <p>. . And much to the embarrassment of the prosecutor, Hoffa was able to bring in documentary evidence as well as witnesses to prove It.</p>
        <p>Afterward. I asked the U. S, Attorney why, with the help of Bellinos memo, he had not been able to get his dates ahd places straight. He made the astounding admission that he had not read Bellinos memo.</p>
        <p>Kennedy cite other similar acs-es of Incompetence, ineptitude or perhaps worse. He says: Furthermore, many of the cases that we sent to the Justice Department for possible prosecution lay dormant for ten months, a year, and sometimes even longer.</p>
        <p>A man who has had this kind of experience with the Attorney Generals office is likely. If appointed to the job. to clean up that agency of government</p>
        <p>which traditionally is a favor-giv-for</p>
        <p>ing outlet ter an Administration.</p>
        <p>The Department of Justice has several functions, not the least important of which is the speedy "</p>
        <p>prosecution of malefactors on an impart</p>
        <p>utterly nnpartial basis. The ad-(.Continued on page 5)</p>
        <p>same trading principi is true for the countries of Central America, and even &amp;amp;)uth America: they have the land but lack the marketing facilities for their fruits, coffee, and even minerals. including oil.</p>
        <p>This is another refson why I feel investors should have tiie larger proportion of their common stocks in marketingrtsth-er in farming, mining, or manufacturingpropositiwis. Whatever the future may bring as to the ownership land or the production of crops or the extraction of minerals and oil, there should always be a field for companies engaged in the marketing -i. o$ tb^ ^ ^products. This wpuea. to tne J^lg concerns such as Sears Roebuck, Montgomery Ward, etc.; but especially to the large- variety chains, witii U^eir stores in all fifty states* of the Un^. Even in case of World War m, these great marketing organizations might come through the best of all concerned.</p>
        <p>LENGTH OF THE CASTRO REGIME</p>
        <p>When Castro, at thirty-two years of age, conquered Batista and his gang. I thought he was a wonderful fellow. As long as he stuck to military warfare, he fared well; but since he has tackled economic problems, he is ruining the country. How long  he can hold out, even with Rus-  *</p>
        <p>sias blessing, no one knows. It seems he Is destined to be assassinated by 8ome&amp;lt;me whose family he has ruined.*</p>
        <p>On the* otherhand, investors should realize that the whole wQ|ld Is passing through % leveling process wherein those who have not are gradually taking away from those who have. In Russia and her satellite countries. this has been done by ruthless stealing of iwoperty. In China, goodwill is expropriated, but Mao has sometimes made payment, on his own terms, for actual property taken. Great Britain has experimented with nationalization, and pajmaent has been made for the coal mines, steel companies, railroads, and public utilities tiukt were taken over.</p>
        <p>In these United States, the labor lead*s have the same goals, but they wtH-k through strikes and uh|Mr demands. In all countries, ^vestors are being attacked either by heavy taxation or by guerrila warfare such as is taking place in Africa. Hence, we investors In the U.S. should be eiH&amp;gt;ecially on the watch. With only 6 per cent of the people of this world, we have (Continued on page five)</p>
        <p>r</p>
        <p>Fourists Face Curb On Spading</p>
        <p>Opinions In Briei</p>
        <p>Progress always Involves risksyou cant steal secottd base with one foot on first. Pickens &amp;lt;S.C.) Sentinel.</p>
        <p>"In the days of our forefathers, rec'OlutiOn was an honorable word. Today it has fallen into disrepute.  Lima (Ohio News.</p>
        <p>Someone recently Informed us about his visit to the Tomb of the Unknown Soldier in Arlincton Cemetery i Virginia. Said he met the widow of the unknown soldier.</p>
        <p>By ELMER ROESSNER</p>
        <p>One of the first actions by tiie new Congress to dam the drain of gold will be legislation to reduce the duty-free merchandise American travelers may bring home.</p>
        <p>The present law permits travelers who have been abroad 12 days to bring in $500 worth of duty-free goods once each six months. Those abroad more than 48 hours dan bring in $200 worth.</p>
        <p>This provision was enacted when the United State.s was trying to restore the war-wrecked economies of foreign nations. Now some of their economies are healthier than ours.</p>
        <p>Travelers bring back* almost $1 billion worlii of duty-free gcods each year. In addition, they are allowed to send gifts costing no more than $10 duty-free. By sending series of gifts of themselves, such as monthly parcels of handmade Japanese silk shirts, they swell the total. OPPOSITION BREWING</p>
        <p>This IjiFon spent abroad by travelers eventually finds its</p>
        <p>way to central banka and can</p>
        <p>become a liability on the U.S, gold supply.</p>
        <p>Cutting duty-free imports will not only save gold but will also please many American voting blocs. Retailers, wholesalers and importers are complaining that travelers Imports are hurting their business. For instance. Its difficult to sell a $350 duty-paid German camera to a prospect if his Uncle Louie can bring it back from Berlin duty-free for $230. Dealers In watches, jewelry, spirits, textiles, garments, handicraft and other valuables are losing money in this foreign competition.</p>
        <p>Furthermore, almost no foreign country allows American merchants to sell so much dutyfree merchandise to their nationals.</p>
        <p>The arguments are almost unanswerable, the new Congress will act fast.</p>
        <p>TEXTILE OFF-BEAT</p>
        <p>Here are other predictions in biislnes.s;</p>
        <p>Textile dip: Sales rose during the first nine months of this</p>
        <p>year, partly because of f&amp;lt;Hnvard buying. Now many companies are living on inventory, orders are down and backlogs thin. Prices will continue weak.</p>
        <p>Clotiiing bargains: Too much Indian summer has slowed buying of winter clothing In many sections of the country. Retailers, forced to move stocks, will soon be offering good clothes at deeper cut prices earlier than before. Shrewd shoppers will find great bargains.</p>
        <p>Deeper gas cuts: Seasonal gasoline cuts take place at this time of year, but the coming cuts will be deeper than in recent years. Gasoline stocks are high.</p>
        <p>Even deeper fuel oil cots:. Fuel 0il holdings are even higher than normal because of the mild fall. Most dealers are holding prices up. In hope that sudden cold snaps will relieve their Inventories. But where winters continue mild, fuel oil ixlc-es will be sharply shaved.</p>
        <p>TWO MONTHS LEFT TO SHARPEN UP The nations lead pencil maa-</p>
        <p>ufacturers will sponsor Pencil Week starting Feb. 27. Anybody using a ball point that week la an old meanie.</p>
        <p>GET OT SEATS,</p>
        <p>OLD PROMOTER URGES When the Old Promoter came in today, he was wearing a small button with the letterg O. S. Wo asked why.</p>
        <p>Im founding tho Gl-der of Off-Seaters, he replied. I have been in business a long time. I have found that the best executives and the finest employees are off-seaters. That is, they get off their seats to get business, A salesman may make an order phoning a prospect from his chair, but hell never get as many and as big orders as the salesman who gets off his seat and see the prospect personally. Another O S Is the secretary who gets off her seat and goes to the mall room to find an important incoming document. instead of using an Intercom to locate it.</p>
        <p>Perhaps the Oil One is right But he surely looked comfortable there in my visitors* chair*</p>
        <pb facs="00087514_0005" />
        <p>Monday, DecetnW 8, 1880</p>
        <p>THE DAILT RCFLCCTOR, GREENVatE. If. C</p>
        <p>RAGE FIVE</p>
        <p>WCTC</p>
        <p>Radio</p>
        <p>MONDAY 4:Od-WOTC News 4 ;06People's Choice 5:00Reflector Headlines 5:08Peoples Choice 8:48--Sports Today 8:00-Wall Street Report 0:06Evening Show 6:30State News 6:35-Joe Overman-Weather  6-^5Evening Show 7:^WGTC News 7 ;05Evening Show 8:00ACC Basketball 10:00v;OTC News 10:05SfarJl'Tht Serenade :i:00WGTC Headlines 11:01Starlight Serenade 12:00WOTC News-eports Weather 12:06Oood Night</p>
        <p>TUESDAY</p>
        <p>5:30Sign On 6:31Farm Hour 0:00-WOTC News 0:05Farm Hour 0:30WOTC Farm News 0:35 -Farm Hour  t</p>
        <p>7:00WGTC News 7:05- -Morning Show 7:30State Nbws 7:35Joe Overman-Weather 7:45Morning Show 8:00WGTC News 8:05Mr-ning Show 8:58Baby Births 9:00-WaTC News 9:05Man About Music 9:30Social' Calendar 9:35Man About Music 9:55OWtuary Report 10:00WGTC News 10:05Man About Music 10:30Community Calendar 10:35Man About Music 11:00WGTC News 11:05Man AlJout Music 12:00WOTto News 12:08Farm Hour ia*88-6tate News 12:35Joe Overman-Weather 12:45Farm Hour j.:00WGTC News 1:05Peoples Choice 2:00WOTC News 2:05Peoples Choice 3:00WGTC News 3:05-Peoples holce 4:00-WGTC News 4:06Peoples Choice 5:00Coke Show 5:30People's Choice 5:45Sports Today 0:00Wall Street Report 6:06Evening Show 0:30State News 6:35Evening Show 700-WOTC News 7:05Evening Show 8:00ECC Basketball 1C:00WGTC Newt 10:05Starlight Serenade 11:00WOTC Headlines 12:00WGTC News - Sport* Weather 12:08Oood Night</p>
        <p>Experienced Cast Playing In %ady Not For Burning</p>
        <p>With PriscillA.Kilgdi'e of Greenville and Peter 4oh&amp;amp;ot Trails Corner, Groton, Conn., in the leading roles, Christopher Prys The Ladys Not For Burning is in final rehearsals for presentation by the East Carolina College Playhouse Dec. 8, 9 and 10. Both principals in the cast, students at the college, have a varied background in the theater.</p>
        <p>Three performances of the Pry comedy are scheduled for 8 pjn, in the McGinnis auditorium on the East Carolina campus The play will be presented by the college dramatic club as one of a series of major productions for 1960-1961 which began last October with The Phadelphia Story Miss Kilgore was co-founder and co-producer and for seven years owner of the Barksdale Memorial Theatre at Hanover, Va. For a season she was with Rounders on the River, summer stock com</p>
        <p>pany, St. Clair, Michigan. For WTVR, Richmond, Va she did commercials and had her own show Perkyfi Parlor. She has also made documentary films for Tantamount Studios in Richmond.</p>
        <p>Johl, student of music at East Carolina, received training in the American Theatre Wing and the Juilliard School of Music. From 1954 to 1959 he played more than a dozen roles in musical comedy stock in Hyannis, Mass; Kansas City; Toronto; and NorUi Tonawan-da, N.Y, In 1959-1960 he toured with the Grass Roots Opera Company. He has had experience as stage manager in productions at Syracuse and Rocheater, NY., and elsewhere. He is a member of Actors Equity Association and the Screen Actors* Guild. He is the son of the late Col. and Mrs. Max O. Johl of Trails Corner, Gro-;4on, Conn.  .</p>
        <p>In Frys comedy of England. In</p>
        <p>1400 Johl has the role of as Mendip, discharged</p>
        <p>Cases Heard In City Police Court</p>
        <p>whose wish to be hanged arises from his revulsion from the worlds wrongs. Miss Kilgore plays Jennet Jourdemayne, accused of witchcraft.</p>
        <p>Dr, Robert T. Rickert, acting director of the East Carolina Playhouse, is direction of The Ladys Not for Burning. His student assistants are Ben Avery of Goldsboro and Rose Gornto of Wilmington, Costumes for the play were designed by art students working under the direction of Paul Minnis of the art department.</p>
        <p>Others who will appear in the cast of the play are Carole Bar-ham of Rt. 1, Seaboard; James Bateman of Danville, Va.: Lois Garren of Greenville; Sanford Peele of Rt. l. Wilson; Douglas Mitchell of Greenville: Thomas Hull of Durham: and Pierre Ben-mouyal of Morocco.</p>
        <p>On December 3. the following , cases were tried in Municipal R4-Thom-! corder's Court by Judge Charles soldier h. Whedbee.</p>
        <p>Sunday^8 Orchestral Concert Proves Satisfying Experience</p>
        <p>Wouldnt Appear In Same Room</p>
        <p>UNITER MXI0N8, N.Y. (AP) Spokesmen lor Israel and Jordan. appeared on the same television program Sunday  but, at Jordans request, they were in separate rooms.</p>
        <p>The program was CBS-TVs .N, In Acuon, recorded on tape last week. Foreign Minister Amusa Naslr of ^Jordan was Interviewed in one conference room and UJ4. Ambassador Michael Comay of Israel in an adjoining room.</p>
        <p>Revival Services To Begin Friday</p>
        <p>FARMVILUSRevival services are scheduled to begin at the r.irmville Pentecostal Holiness Church Friday nlfbt and continue through Dec. 18.</p>
        <p>Evangelist Clayton Guthrie of Harkers Isiand' will be the (Uest speaker at the 7:30 p.m. services.</p>
        <p>By JAMES H. PARNELL</p>
        <p>Sunday afternoon a large and appreciatelve audience gathered in Wright Auditorium for the 19^ 61 debut of the East Carolina College Orchestra under the able direction of Donald H. Hayes. Throughout the concert the orchestra proved once again that it can present commendable performances of music of all styles.</p>
        <p>The program opened with a rather cautious rendition of the First Movement of Brahms Second Symphony. Mr. Hayes and the members of the orchestra placed ^eat emphasis upon the lyrical qualities of this music, but. In so doing, the rhythmic and dramatic elements seemed to be somewhat lax. Many professional muei-cians contend that the music of</p>
        <p>Sokolsky Col.</p>
        <p>(Continued from page f6ttrl</p>
        <p>ministration of the Federal Courts lies within the jurisdiction of this Department. The President makes judicial appointments on the recommendation of Uie Attorney General. Too often, this is a patronage-ridden agency and Federal judges who were who were once regarded as sacrosanct have not, in recent years, been regarded so favorably.</p>
        <p>The FBI, the Federal Bureau of Investigation, is not an independent agency of government. It is a department of the Department of Justice. J. Edgar Hoover has, in his own person established such a prestige that Attorneys General and even Presidents come and go but Hoover stays on and the FBI remains free from departmental interference. Nevertheless, it needs to be said that if an Attorney General desired to abuse the FBI, he could do It. Hoover would, of course, resign under such circumstances. Only the bandits would benefit.</p>
        <p>To summarize, ^were John F. Kennedy not President, there could be no objection to his brother, Robert, being appointed Attorney General. His career would justify it. Therefore there can, in justice, be no objection now.</p>
        <p>fiabsoD</p>
        <p>(Continued from page four) nearly half of the worlds wealth. Can this condition always continue? The leveling trend has been going on for centuries. Though I am still hopeful as to Cuba, yet let us keep in mind this world fl-end.</p>
        <p>Brahms is among the most difficult to perform correctly; however, the ECC Orchestra presented a satisfactory account of this masterpiece.</p>
        <p>After a sensitive performance of excerpts from Handels "Water Music, the group turned to a contemporary American work  in their reviewers estimation the highlight of the concert. John Barnes Chance, a young Texas-born composer who is a compos-er in residence at Greensboro this year, conducted the orchestra in a stirring presentation of his Symphony. It is the policy of the ECC Orchestra to champion the works of our American composers, and the Entertainment Series Is to be congratulated for its efforts in bringing these composers to our Campus to conduct their own compositions. The Chance symphony reminded this listener of Shostakovich and Prokofiev; but it contained much original material in the true American idiom. This number is cimracterlzed by good m/odic content, contemporary scoring devices, and a strong rhythmic drive. It will be interesting to follow Mr. Chances future development as a composer.</p>
        <p>Following the intermission, Mr Hayes returned to lead his forces in an authentic account of the Emperor Waltz" of Johann Strauss.</p>
        <p>To close this successful concert,</p>
        <p>the orchestracomplete with solo speakers and s speaking chorus erformed flie Declaration uitc by the American composer Morton Gould. Mr. Gould is noted for his excellent arrangements and colorful orchestration. Although this work does not appear to be one of his better compositions, it does contain some rather exciting passages. It is a difficult piece, and It requires the utmost in performing skill by all concerned.</p>
        <p>In summary, this initial* orchestral concert of the 1960-61 academic year proved to be a very satisfying experience. There were, of course, occasional intonation difficulties, some faulty entrances, and problems of balance (some due to the acoustics of the auditorium); but, these were overshadowed by many notable examples of fine musicianship. Mention should be made of the outstanding work by the trombone section. However, it was the combined effort by the entire Orchestra and its conductors which produced this interesting program.</p>
        <p>There was one disturbing factor during the concert; audience noise. There were many late arrivals. and resulting noise and confusion made it almost impossible to enjoy the soft portions of the Bmhms and Handel composi tions. Perhaps as the concert sea' son progresses, our concert etiquette will Show improvement.</p>
        <p>Most Democrats In House Favor January 4 Caucus</p>
        <p>Willie U Jonea. Negro, 606 Bancroft Ave., speeding, pay costs; Jiimmy Roger Skinner, 206 E. 12th St., assault on a female, continued to; Cora T. Roach, 000 W. Fourth St., assault with a deadly weapon to kill, continued to; Linda M. 'Tyson, Rt. 1, Farmville, speeding, pay $20, costs deducted; Daniel Lee Blount, Negro, Rt. 1, Box 133, Greenville, careless and reckless driving, pay $26, costs deducted and $20 for the Rescue Squad; and careless and reckless driving, nol prossed; Larry Kent Benton, 408 Warren St., Kinston, no operators license, not guilty; and carrying c&amp;lt;icealed weapon, not guilty; Gene Cooper Haddock, Bt. 2, Box 345. OreenvUle, operating under Influence, not guilty; Johnnie Jenkins, Negro, 1218 Clark St., embezzlement, not guilty; Sherry R. Gilbert Cox, 2604 Tyron St., no liability insurance, pay costs; no operators license, combined with the above case and fail to transfer ownership of title, combined.</p>
        <p>Ben Klnlon, Hotel Orecnvllle, drunk, 30 days In jail and on th# roads, appealed to Superior Court; drunk, 80 days at expiration, appealed to Superior Court; Aztr-lean Edge, Negro, 304 Reade St., poisesslng non-tax-paid whiskey for sle. 00 days in jail, suspended, pay $60, costs deducted and not have in her possession any intoxicating beverage for two years; Jlnnls Earl Taylor, Chestnut St., drunk, 30 days, suspended, pay $16, costs deducted; Clarence Harris, Rt. 6, Box 342, Greenville, fail to yield, pay costs; William Bruce Hardee, Rt. 8. Box 553, Greenville, assault with a deadly weapon, plead guilty to simple assault, 30 days, suspended, pay Into court for John R. Cox, $3.00 for Medical Arts Clinic, $26 for Leslie Cox, $15 and pay $20. costs deducted; Norwood D. Conway, Cotanch St., drunk, 30 days, suspended, pay $16, costa deducted; Herbert Teel, Negro, 901 Legion St., drunk, 30 days, suspended, pay $16. costs deducted; Johnnie Hawkins, Negro, 1903 8. Fitt St., driving after license expired, pay coats.</p>
        <p>Saw No Rift In Moscow Meeting</p>
        <p>ROME (AP) - A top ItiUan Communist, who attended the recent Communist summit Conference at Moscow, said Sunday two documents approved there will disappoint those who hope for a rupture In Communist ranks.</p>
        <p>Lulgl Longo said the documents, which will be prtnted soon in Communist party organs around the world, were unanimously approved by the representatives of 81 Communist parties attending the Moaoow meeting.</p>
        <p>RALEIGH (AP)A poll ihows that a majority of the 105 Democratic members of the House of Representatives favor holding a caucus here Jan. 4 to nominate a speaker and other elected House officials.</p>
        <p>The caucus would be held the day before Gov.-elect Terry Sanford and other state officials are inaugurated.</p>
        <p>Reps. H. Clifton Blue of Moore and Herbert W. Hardy of Greene conducted the poll. Blue said that up through Saturday they had heard from 70 House Democrats, 65 of whom favored the Jan. 4 caucus. Three were agalnat it, one was undecided and one said anytime suited him.</p>
        <p>In their letter to the Democratic House members, Blue and Hardy said Rep. Joe M. Hunt Jr. of Guilford, unopposed candidate for speaker, concuors in the idea to hold the caucus.</p>
        <p>Blue and Hardy added the caucus In no way would necessitate a special session of the General Assembly, or any additional expense upon the state in any way. . The expense of the trip would, course, be bourne by</p>
        <p>of</p>
        <p>ual members.'*</p>
        <p>They added, we think it would be mighty nice for Hunt to be nominated speaker by the House Democrats at the time Sanford is takinf over as governor, and H,. (floyd Phllpott assumes the lieutenant governorship. Hunts formal election to tne speakership would come at the official opening of the General Assembly in February.</p>
        <p>Boys Caught In Extortion Plot</p>
        <p>HENDERSON. N.C. (AP)  An extortion plot, supposedly inspired by a television program, today will bring two 15-year-old Negro boys into Juvenile Court for a hearing</p>
        <p>Archie Green and Melvin Har-prove were nabbed by police Saturday night after a chase from the scene where Mrs. Ernest Walker had been instructed to leave $25.</p>
        <p>Police Capt. J R. W.ilkerson, one of two officers who accom-, panied Mrs. Walker to the open</p>
        <p>Pilot Ejected Too Low: Killed</p>
        <p>DENVER, Colo, (AP)  Air Force Capt. Lawrence R. Reeves. 29, of Sterling, Colo., was killed Sunday when be ejected from his disabled F102 Jet fighter 100 feet from the groundtoo low for his parachute to open.</p>
        <p>His plane crashed north of Buckley Field and burned-</p>
        <p>Reeves had just taken off for a return flight to Portland International Airport, where he waa assigned to the 406th Flghter-ln-teroeptor Squadron, when bla plane developed engine trouble.</p>
        <p>DISTRICT MEETING</p>
        <p>The Pitt District of Scoutera meeting is scheduled for Jarvis Memorial Methodist Church at 7:45 tonight.</p>
        <p>All members are urged to be prmnt.</p>
        <p>andbag... appiest</p>
        <p>Every woman of faihlon will be deligbted to find one of our xquliH handbag tudcod in Her Christmas Stocking. And w havo handbagi large and unali... dark and daylfi^t design**</p>
        <p>$2.99 up</p>
        <p>Larry's Shoe Store</p>
        <p>WAYS TO A PERFECT FIT At S Polntz</p>
        <p>the individ- field on the outskirts of Hender</p>
        <p>son, said the two youths admitted complicity in the case.</p>
        <p>Green told officers he got the idea from a ahow on television.</p>
        <p>Clip Coupon Mail Today f</p>
        <p>Enjoy A</p>
        <p>BRODYS</p>
        <p>CHARGE</p>
        <p>ACCOUNT</p>
        <p>NOW!</p>
        <p>Why shop the old-faahioned way .  . when a Brody charga account i* ao easy to opan . .. ao easy to uae! Youll naver hawa to paaa up a brand new faahlon or skip a tala. Why wait . . . hava the things you want now .. just fill out the coupon and matl it today.</p>
        <p>Brody*</p>
        <p>1 would like to open a Brody charge account.</p>
        <p>Nama .......................................</p>
        <p>Addre**  ..................................-</p>
        <p>City ..............  State  ...</p>
        <p>I have accounts with  </p>
        <p>My bank 1* ........................m.......</p>
        <p>GIFT BAR</p>
        <p>EXPECT A GLOW WHEN YOU GIVE A GIFT FROM</p>
        <p>Brody's</p>
        <p>(lifts From fl.OO To '4.95</p>
        <p>Perfect PeU!</p>
        <p>Stuffed</p>
        <p>Animali</p>
        <p>Ideal for that someone who has everything. Yof choice of animals See onr selection today.</p>
        <p>Deer, Doff, Cats, Monkeys. Tigers, Bears, Walms and Many Moro</p>
        <p>$1.00 to $3.95</p>
        <p>Ut</p>
        <p>Fashionable to Givo</p>
        <p>Lg-0-Tards</p>
        <p> AJl filiot</p>
        <p>^ 0 Cmnpletely StretchablO</p>
        <p> All Colours</p>
        <p>Wm $2.95 NOW .</p>
        <p>Was I3.9S NOW . .</p>
        <p>$1.99</p>
        <p>$2.99</p>
        <p>A Spedai Saving For The Httdfotwiso At Christmas</p>
        <p>Elegant Gift</p>
        <p>Travel</p>
        <p>Kit*</p>
        <p>Holds anything for travel .   toothbrufh, tony, powder, eologno toilet water.</p>
        <p>$2.95 to $4.95</p>
        <p>'1.00</p>
        <p>to</p>
        <p>'2.95</p>
        <p>Pompar Her With</p>
        <p>Sachets</p>
        <p>a Many Fragrances</p>
        <p> Many Stylio</p>
        <p>a Perfect for ClMct a Ideal for Dresaer</p>
        <p> A Miial For All Women</p>
        <p> Many Different Colors</p>
        <p> Get a Gift of Sachet Today for tonaeodo Who Likes Nloe ThJngs</p>
        <p>Hostess Gifts</p>
        <p>Memorancum psd for  that  $4 .95</p>
        <p>daily reminder ...  -</p>
        <p>Bridge Score pad* complete  $4 .95</p>
        <p>with pencils .  .  *</p>
        <p>Free Gift Wrapping !!</p>
        <p>Each gift wrapped for the holiday season with the newest in Christmas foils and ribbons.</p>
        <p>Thoughtful extras! for</p>
        <p>Christmas *  </p>
        <p>Musical ChristmRs</p>
        <p>Trees</p>
        <p>Your Choice of Tnnes    Silent Night "Jingle Bella</p>
        <p>$4.95</p>
        <p>An Ideal glri that will last from year to year. Kxpect a gi(.*w when you gtvo a gift from Brodys this holiday season.</p>
        <p>Gifted Ida*</p>
        <p>Puff*</p>
        <p> Btroteh Puffs to Fit Any Size</p>
        <p>a Blue, White, Groen, BUck and Red</p>
        <p>a Tinaelsd to Give A Holiday Glow In Footwear</p>
        <p>$1.00</p>
        <p>WALLETS</p>
        <p> Genuine Leather a All Coloars</p>
        <p>a For the Lady of Your Choice at Christmas</p>
        <p>One group of wallets One group of wallets</p>
        <p>1.00</p>
        <p>2.95</p>
        <p>Gloves</p>
        <p>Yes, we have the flovoo she loteo .  . irarm gloves, driving gloves, sports gloves, town gloves.</p>
        <p>A Complete Selection of Combination Fabric and Lcathsr Glovos</p>
        <p>$1.00-$3.00</p>
        <pb facs="00087514_0006" />
        <p>fAGC SIXTHE DAILY REFLECTOR, GREENVILLE. N. CL</p>
        <p>ModtLj, Decemtier 8, IMS</p>
        <p>Crossword Puzzle</p>
        <p>Acmoss</p>
        <p>t. Pin in a stringed Instrument</p>
        <p>4, Melt</p>
        <p>5. Embark</p>
        <p>12. Used in rowmg</p>
        <p>13. Cavity</p>
        <p>14. Inland body</p>
        <p>of water is. Pledge</p>
        <p>17. Torn apart</p>
        <p>18. Money</p>
        <p>19. Interweave</p>
        <p>20. Address 12. Official</p>
        <p>permit is. Sour</p>
        <p>16. Tapering solids</p>
        <p>17. Part of verb 'to be*</p>
        <p>18 Some 19. Strength</p>
        <p>SO. Candle</p>
        <p>31. New England Stale; abbr.</p>
        <p>32. Number</p>
        <p>33. Period of fasting</p>
        <p>34. Large serving dish</p>
        <p>86 Out of practice</p>
        <p>37. Exploit</p>
        <p>38. Small depression</p>
        <p>39. Experiment</p>
        <p>41. Geometric'</p>
        <p>figure</p>
        <p>44. News</p>
        <p>45. Inanimate</p>
        <p>46. Poem</p>
        <p>47. Mind</p>
        <p>48. Solely</p>
        <p>49.Howevi '</p>
        <p>DOWN</p>
        <p>1. Carbonated beverage</p>
        <p>0</p>
        <p>5.</p>
        <p>A</p>
        <p>C</p>
        <p>A</p>
        <p>S</p>
        <p>o</p>
        <p>1</p>
        <p>a</p>
        <p>P</p>
        <p>o</p>
        <p>p</p>
        <p>A</p>
        <p>L</p>
        <p>t"</p>
        <p>0</p>
        <p>A</p>
        <p>R</p>
        <p>0</p>
        <p>A</p>
        <p>A</p>
        <p>A</p>
        <p>O</p>
        <p>A</p>
        <p>T</p>
        <p>1</p>
        <p>N</p>
        <p>r</p>
        <p>A</p>
        <p>G</p>
        <p>L</p>
        <p>e</p>
        <p>II</p>
        <p>B BBQ a</p>
        <p>3 33333 333330133</p>
        <p>aaa Baas</p>
        <p> QBE 3331 13 333 331  333 033 33333</p>
        <p>333 asa</p>
        <p>303 33 QBDQnCI OQ Q0CS 30 3333</p>
        <p>o</p>
        <p>T</p>
        <p>T</p>
        <p>C</p>
        <p>ri</p>
        <p>Solution of Yeatorday'a Puzzle</p>
        <p>2. Com spike</p>
        <p>3. General store</p>
        <p>4. Meditate</p>
        <p>5. Multitude</p>
        <p>6. Beverage</p>
        <p>7. Ourselves</p>
        <p>8. Divides into parts</p>
        <p>9. Port 10. The</p>
        <p>Presiden.</p>
        <p>A8</p>
        <p>IZ-ft</p>
        <p>1!. Quill</p>
        <p>16. Food</p>
        <p>17. Black snake</p>
        <p>19. Woven flax</p>
        <p>20. Trample</p>
        <p>21. Rectangular inset</p>
        <p>22. To humiliate</p>
        <p>23. Canonize# person</p>
        <p>24. Unoccupiei 26. Desire</p>
        <p>wrongfullp 29. Leaf of a corolla .30. Nullify</p>
        <p>32. Continuous</p>
        <p>33. Breathing organ</p>
        <p>35. Burning</p>
        <p>36. Quick in action'</p>
        <p>38. Use a telephone</p>
        <p>39. Number</p>
        <p>40. Rifle</p>
        <p>41. Beasts habitation</p>
        <p>42. American author</p>
        <p>43. Converged 45. Answer the</p>
        <p>purpose</p>
        <p>USAF Chaplain Will Visit ECC ROTC Cadets</p>
        <p>Favorable Reaction To Protestant Reunion</p>
        <p>PAR riMI n MtH</p>
        <p>90 MPH Pursuit Of Dead Deer</p>
        <p>the street.</p>
        <p>The driver, Earl Snell, 1^. &amp;lt;rf Louisville, was charged with reck* less driving and grand larceny.</p>
        <p>Support Nixon As GOP Leader</p>
        <p>LOS ANGELES (API ~ CaU*</p>
        <p>LOUISVILLE, Ky. fAP)  The cheetah is the fastest animal alive but its speed couldnt match the 90-mile-an*hour chase it took to run down James Thomas Wnght's</p>
        <p>dead deer.    .    ,</p>
        <p>Wright, 38. telephoned Police</p>
        <p>ftunri&amp;amp;v  And  isa.id  &amp;amp;oixi&amp;amp;on6  h&amp;amp;d  Coniniittcc  pledged coxnplctc</p>
        <p>Sunday  ana  saio  someone  naa  ^  President Richard</p>
        <p>M. Nixon as head of the Republi* can party.</p>
        <p>The committee aent Nixon a telegram Sunday, congratulating the defeated  GOP presidential</p>
        <p>candidate on hia majority in California.</p>
        <p>State Chairman John Krehbiel said Nixona victory In hia home state showed a clear repudiation of Democratic  Gov. Edmund G.</p>
        <p>Brown's administration.</p>
        <p>By GEORGE W C.ORNELL Associated Press Religiua Writer SAN FRANCISCO (AP)-Leading churchmen today registered a somewhat bedazzfed but firmly favorable reaction to a proposal for a wide reunion among American Protestants.</p>
        <p>The plan, said Methodist Bishop John Wesley Lord, of Boston, is as shocking as it is Christian."</p>
        <p>It overcomes with stark simplicity many of the problems that have perplexed the separate com-niunions over the years.</p>
        <p>The plan, at the outset, would embrace the Episcopal, United Presbyterian, Methodist and United Church of Christ with other</p>
        <p>denominations subsequently invited to join.</p>
        <p>The provocative formula was offered Sunday by a top-ranking Presbyterian, the Rev. Dr. Eugene Carson Blake, of Philadelphia, shortly before the start (rf phia, shortly before the start of the National Council of Churches.</p>
        <p>More than 3,(KK) representatives of 33 Protestant and Orthodox denominations with 40 million members joined Sunday night in the stirring opening services.</p>
        <p>Although not formally a part of their program, the proposal generated keen interest among delegates.</p>
        <p>10-Year Film Drought For Gloria Jean Ends</p>
        <p>stolen his deer while he was having coffee at his restaurant here. He had tied the 10-point buck to his car after shooting it earlier In the day.</p>
        <p>Two officers nearby spotted a car speeding by with a deer on the seat beside the driver. They gave chase, firing three warning shots into the air.</p>
        <p>The vehicle turned a comer, went out of control, and hit a parked car. The deer plopped onto</p>
        <p>Science Shrinks Piles New Way Without Surgery Stops ItchRelieves Pain</p>
        <p>II. TMk. R. T. (S9W11) - For th flret tmo oeieace has foond a new healing aabstance with the astoa-lahing ability to ihriok heaor-rhoidi, atop itching, and relieve pain  without surgery.</p>
        <p>In caae after case, while gently relieving pain, actual reduction (ahrinkage) took place.</p>
        <p>Moat  of  allreaolti were</p>
        <p>M thorough that luffevera made astonishing statement! like Pilee have ceased to be a proWeml*</p>
        <p>The secret ia a new healing wA-stance (Bio-Dyne*)discovery e&amp;lt; a world-famous research institute.</p>
        <p>This substance is now available in tuppotitorjf or etatment form under the name Preparatta H*. At all drug counters.</p>
        <p>LT. COL. R. W. TINDALL</p>
        <p>. Chaplain, Lt. Col., Robert W. 'Hndall, . S. Air Force, wUl visit Detachment 600 of the AP ROTC at East Carolina College Friday, December 9.</p>
        <p>WhUe on the campus, Chaplain Tindall wlU consult with Lt. Col. Norman P. Merritt, Jr., professor of air science, and members of his staff; with cadets Interested In the chaplains program of the U.S. Air Force and other cadets; and with wives and fiancees of cadets.</p>
        <p>Chaplain Tindall, a native of Washington State, was educated at the University of Oregon, Northwest Christian Co'lege, and Phillips University. He htlds the honorary D.D. degree from Jackson College in Hawaii and is a gtaduate of the War College, Air University, Maxwell AFB, Alabama.</p>
        <p>He la an ordained minister of the Disciples of Christ Church and his pastorate was in Waynoka, Oklahoma.</p>
        <p>Commissioned In the US Army Air Corps March 1943, Chaplain Tindall attended the Chaplains School, Harvard University. During World War n, he served overseas with the 442nd Trobp Carrier Group in Europe. He was Base Chaplain at March AFB. Langley APB, McCord APB. Hickam APB, and was Staff Chaplain of the 25th Air Division, and AP Liaison Chaplain of Arlington National Cemetery.</p>
        <p>Chaplain Tindall was awarded the Pour Chaplains Award" In</p>
        <p>By BOB THOMAS</p>
        <p>HOLLYWOOD (AP) - Everythings coming up you-know-how for Gloria Jean, appearing in her first movie in 10 years.</p>
        <p>But the former child singing star isnt giving up her job as hostess at a San Fernando Valley eatery.</p>
        <p>Readers of this space will recall a report a few weeks ago that Gloria had taken the job to tide her over until she could get back into the show business she had known most of her life.</p>
        <p>Jerry Lewis happened to read the report. He sent for Gloria.</p>
        <p>How would you like to appear in my new movie, Ladies Man? he asked.</p>
        <p>WhyId like nothing better, she answered in amazement.</p>
        <p>All right, youve got the part," the comedian said.</p>
        <p>But dont you want to test me or have me read for the role? she protested.</p>
        <p>Nope. I like to do things for people. Youre it for today.</p>
        <p>So Gloria is now doing one of the leads in the new Lewis opus, ending a long career-drought and a series of personal mishaps, including the loss of her fiance in the Korean War.</p>
        <p>I feel just wonderful, she said. My only trouble Is that I cant get enough sleep. Im too excited to sleep.</p>
        <p>What kind of a part does she have?</p>
        <p>I dont know exactly, she said. Jerry wont show us the script. We only have the first 40 pages. When we finish shooting that, heU give us the next 40.</p>
        <p>The plot has Gloria as one of several dozen career girls living in a Hollywood dormitory with Helen Traubel as house mother. Jerry is a dame-haunted movie</p>
        <p>Im going to sing a number with Miss Traubel, Gloria added excitedly. Im sorry that Ive been so busy that I havent been able to do some lessons. But Ive been singing around the house, and the voice is still there. What else has happened to her? She got her break-in to the acting field again by, doing a role on MacDonald Careys TV series, Lock-pp.</p>
        <p>She has been written up by the two top fan magazines  First time since I left pictures. Tonight she tapes Ben Alexanders TV show, About Paces.</p>
        <p>Despite all this activity, Gloria hasnt deserted the Tahitian, the studio city spot where she has been hostess.</p>
        <p>I wouldnt want to quit, she declared. But I have cut down to working Saturday nights only while Im on the picture.</p>
        <p>It is the opening of a very Significant move, said the Rt. Rev. Arthur C. Lichtenberer, of New York, pr^iding bishop New York, presiding bishop of the Episcopal Church.</p>
        <p>Out of this might come a plan that would be acceptable to all the people Involved, he added. It is a good approach. I hope it will lead to a reunion of the church.</p>
        <p>He, li^e others, however, emphasized it wiU take time, and careful examination.</p>
        <p>Dr. Blake, in a sermon at Grace Episcopal Cathedral, detailed steps for combining creedal, liturgical churches with the more iriformal, non-ritualisUc churches into a body both reformed and catholic.</p>
        <p>Episcopal Bishop James A. Pike, of California, called the plan the most sound and inspiring ever offered in this country.</p>
        <p>The plan Is patterned on the precedent-shattering establishment of the United Church of South India in 1947, uniting Presbyterians, Methodists, Eplscopa^-ans and CongregationalJsts Dr. Blake proposed specifically a merger of these four groups in the United States. He Included the United Church of Christ, a presently evolving union of Congrega-tionalists and the Evangelical and Reformed Church.</p>
        <p>Altoether, the combined body would have more than 20 million members. Other churches acdeptr Ing the principles, Dr. Blake said, would also be invited to join, with the ultimate aim of reuniting "the whole of Christs church."</p>
        <p>The Rev. Dr.' James E. Wagner, of Philadelphia, and the Rev. Dr. Fred Hoskins, of New York, co-presidents of Uie newly crated United Church of Christ, voiced great interest and appreciation</p>
        <p>ftnr the plan.</p>
        <p>Th^ said ttey felt sure that if the Episcopal and United Presbyterian conventions next year iMue cans !(* such a union as proposed 1^ Dr. Blake, it will receive careful and thoughtful consideration.* </p>
        <p>However, they expressed hope that the plan would not be limited to the four bodies named even at the start, since their own merger already was planning unity negotiations with the Disciples of C3u1t Church.</p>
        <p>The proposed reuqion would include a Joint consecration service, in which all clery took part, so as to bring them Into the apostolic successiona heritage valued by the Episcopal and other catholic-rooted churches This is a line of authority considered handed down from the apostles</p>
        <p>The plan also would provide for</p>
        <p>truly democratic government, with congregatioBs free to aami their own pastors, and a wldi diversity of theoioical formulations of the faiti) and a wkie diversity of worship and liturgy.; .</p>
        <p>Other measures would ineorpo* rate distinctive features of bclh Catholic and reformed types of Protestant churches. Dr. Blake said. He said he used the word, catholic," as it applied to age-old Christian concepts and pra^ tices.</p>
        <p>The reunited church. he said, must have visible and historical continuity with the churches of all ages befcare and after the Reformation </p>
        <p>He estimated it would take tl &amp;gt;ast 10 years to effect the i... a1 union, if the designated denominations act on it favorably He gested as a possible name: The Reformed and Catholic Church ,n the United States of America </p>
        <p>COUPON</p>
        <p>I</p>
        <p>GOOD FOR 20c</p>
        <p>_l</p>
        <p>I</p>
        <p>I Preset this eonpoo to Ronnies Donut Shop Tuesday, I Wednesday, Thursday or Friday and receive a 75c Gemuui I chocolate cake for only 55c.</p>
        <p>Ronnies</p>
        <p>iCriapy-Krwm Donut Shop</p>
        <p>180S Dickinson Avenae</p>
        <p>1963 and the Air Force Commen- star who escapes his career to</p>
        <p>cation Ribbon in 1959.</p>
        <p>Lodge Delasring Decision On Job</p>
        <p>take a job incognito. Naturally, he ends up at the dornu_</p>
        <p>Guilt Complex Over Hiroshima</p>
        <p>BEVERLY, Mass. (AP)-Henry Cabot Lodge, unsuccessful Republican candidate for vice president, said Sunday he would wait until next month before making decision OB several job offers.</p>
        <p>Lodge returned home after a!was a mental patient, vacation with his wife Emily in 1 Hospital officials said Claude the Virgin Islands. He declined !r. Eatherly, 44, a former Air</p>
        <p>WACO, Tex. (AP)  The pilot who led US. atomic bombers to Hiroshima and Nagasaki has escaped from the Waco Veterans Administration hospital, where he</p>
        <p>comment on reports that he v as offered the editorship of the New York Herald Tribune.</p>
        <p>Outdoor Post Lanterns Make Ideal Christmas Gifts</p>
        <p>Choose from our large selection of styles to match the exterior of your home.</p>
        <p>Ihe Jrixture House</p>
        <p>HOME OF DISTINCTIVE LIGHTING FIXTURES</p>
        <p>Over 400 Fixtures On Lighted Display</p>
        <p>1804 Dickinson Avenue  Greenville,  N.  C.</p>
        <p>Force major, escaped from the institution Nov. 22.</p>
        <p>Eatherly was acquitted of burglarizing two Texas post offices' after pleading innocent by reason of insanity. A grocery store robbery charge at Dallas against him was dropped after he was committed to the VA hospital here last</p>
        <p>^ A psychiatrist testified at his trial on the burglary charges in 1957 that Eatherly had a guut complex and said he felt responsible for killing 100,000 persons at Hiroshima.</p>
        <p>Terrorists Fire At Cafe Dancers</p>
        <p>PARIS (AP)Two gunmen, believed to be Algerian terrorists, opened fire on dancing couples in a crowded cafe Sunday night, killing two persons and wounding six.</p>
        <p>Police said the gunmen may have picked the wrong cafe for the attack. All the victims were Europeans and the cafe owner said he had no Algerians among his clientele._</p>
        <p>EXTENDED WEATHER OUTLOOK FOR N. C.</p>
        <p>Temperatures will average near normal, with rainfall of a half inch or more Tuesday through Saturday. Mild, imtil turning coder about midweek, and small day-to-day temperature changes thereafter. Rain likely during middle of week and again about Saturday.</p>
        <p>LADIES DRESS SHOES, FLATS, LOAFERS, MENS FREEMAN DRESS SHOES, AND LOAFERS . . .</p>
        <p>LADIES SHOES</p>
        <p>Valentine</p>
        <p>Vogue</p>
        <p>Grace Walker Natural Poise Red Goose Children Young Capezio</p>
        <p>MENS</p>
        <p>Freeman John C. Roberts Dress Shoes And Loafers All Cordovan Loafers</p>
        <p>SALE ENDS SATURDAY, DEC. 10th</p>
        <p>JACKSONS SHOE STORE</p>
        <p>400 EVANS STREET</p>
        <p>GREENVILLE, N. C.</p>
        <p>PenneyIs</p>
        <p>ALWAYS FIRST QUALITY!</p>
        <p>BEGINS TOMORROW! PENNEYS FABULOUS JACKET JAMBORIE</p>
        <p>HER PERFECT CHRISTMAS FASHION GIFT!</p>
        <p>High On The Christmas Want List</p>
        <p>Womens All Wool</p>
        <p>Flannel Blazers</p>
        <p> A Clatsic Jacket to wear anywhere</p>
        <p> Styled in all Wool Flannel</p>
        <p> In white, charcoal and other colort</p>
        <p> For Mistes, Women and Teens too!</p>
        <p> A favorite from coast to coast</p>
        <p> With smart crest on pocket</p>
        <p>Styled For Every Occasion!</p>
        <p>BIM I to U</p>
        <p>IMPORTED</p>
        <p>HEEK SUEDE</p>
        <p>This coat Is a fashion must! smart new belted style!</p>
        <p>Fabric imported from Holland! Rust, Red, Green, Beige, Charcoal! Womens* sizes 8 to 18 only!</p>
        <p>The perfect Christmas gift!</p>
        <p>Size S to 29</p>
        <p>Briefly Stated Coat That Goes Over All!</p>
        <p>All Wool Melton</p>
        <p>SHORT JACKETS</p>
        <p>e More Than 250 Jackets To Choose From!</p>
        <p> Deluxe AU Wool Melton!</p>
        <p> Wamtly IJned with Mllinm!</p>
        <p> Dsrk Grey and Medium Grey!</p>
        <p> Youll Wear Them Everywhere! e Very Latest Casual Styling!</p>
        <p> For Yonrasll or for Glvtng!</p>
        <p>SPECIAL ANNOUNCEMENT!</p>
        <p>TUESDAY ONLY  Two Company Jackat Specialist, Mrs. Barbara Martin and Mrs. Eiline Taylor will be at Penneys to assist you in selecting the right jacket, size and color! This advise is free from these jacket experts!</p>
        <pb facs="00087514_0007" />
        <p>Sports</p>
        <p>DAILY REFLECTOR</p>
        <p>Classified</p>
        <p>MONDAY AFTERNOON. DECEMBER 5. 1960</p>
        <p>Greenville Seeks First WinHere Tomorrow Night</p>
        <p>V Orcenvillei basketball team entered the cage Mason wars FMday night in the losing column but aU was not gloom for Coach Bo Farleys men in tennis shoes.</p>
        <p>Tomorrow night, the Phants host Rocky Mount In their home opener. It will be their second clash with the Blackbirds and they hope to avoid a replica of the 43-31 outcome of Friday night.</p>
        <p>Frley, who moans over the lack of rebound atrength in his Uneup, may see his club get a shot-in-the-arm tomorrow night. A 1959-60 regular, Layne Jorgensen returned .to the club today and may be available for spot duty against the Birds.</p>
        <p>Jorgensen,, a husky 6-4 senior, has missed prt-season ^pritl^'nd the opening game due o post-seaMO football honors. He concluded his grid work this yast Saturday, participating with a North Carolina souad of prep stars that bowed to South Carolina in the Shrine Bowl.</p>
        <p>With Jorgensen beck in the lineup, despite his lack of practice, Greenville's stock is expected to ascend. Lack of rebound strength and Inability to shoot proved to be the Phants pitfall In the opener Friday.</p>
        <p>Rocky Mount, which didnt present the Image of a cage giant against Greenville Friday,</p>
        <p>will also be a little stronger with the presence of Ronnie Jackson, who, also placed in the Shrine Bowl.</p>
        <p>Coach Bill Lundy got unexpected scorii^ punch from guard Joe Murril Friday night and will bank on the sharp-shooting senior tomorrow night along with forward Danny Talbott.</p>
        <p>, Junior Rickey Creech, who is 6-3, gave Greenville a pain under the boards Friday but may find the action a little rougher against Jorgensen. Chip Broadfield, 6-1 forward, is the other rebounder in Riwky Mounts lineup.</p>
        <p>John Bynum and Ronnie Knowles provided Greenville with its few rebounds in the opener and will attempt to grab their share tomorrow night. Knowles, a freshman, could be Farleys Ace-in-the-hole before the season draws to a close.</p>
        <p>Guards Kroghie Andresen and Erskine Duff turned in a creditable floor game last week and, alor^ with forwards Billy, James and Alan McArthur, were bglb-hawks defensively.</p>
        <p>The Phants have had only one day to sharpen their shooting eye but It should exceed the Friday night production of U field goals with* only a little improvement.</p>
        <p>Tap-off for the Phants debut before the home fans will be 8:00.</p>
        <p>SENIOR GUARD Erskln* Duff will be In the starting</p>
        <p>.hneup tomorrow night when Greenville oj^s its home season against Rocky Mount. Duff and crew will</p>
        <p>a 43-31 setback last week by the Blackbirds.</p>
        <p>set on revenging</p>
        <p>SCORES</p>
        <p>Saturdays CoUege Footilall By THE ASSOCIATED PRESS UCLA 27, Duke 6 South Carolina 26, Virginia 0 Teim A&amp;amp;I State 25, Jackson (Miss) State 22</p>
        <p>Eastern NAIA Playoff Northern Mich 20, Lenoir Rhyne SO (Lenoir Rhyne awarded game on net yardage).</p>
        <p>Western NAIA Playoff HumboUt State 13, Whitworth 7 ,  Missile  Bowl  ^</p>
        <p>Quantico Marines 36, Pensacola Navy 6</p>
        <p>Hospitality Bowl Pearl River JC 50, San Angelo (Tex) 20</p>
        <p>BASKETBALL TONITE</p>
        <p>L8 vs. North Carolina 7:45</p>
        <p>WGTC1590 KC</p>
        <p>Expansion On Program For NS Meet Tuesday</p>
        <p>HIGH POINT. N.C. (AP)The possibility of expanding the North State Conference, perhaps to include some South Carolina colleges, is expected to be discussed at the conference* annual meeting here Tuesday.</p>
        <p>Dr. D. E. Faust of Catawba, conference secretary, has confirmed that two letter* regarding membership In the conference have been received. He declined to name the colleges.</p>
        <p>Newberry College of South Carolina reportedly is one of the applicant*, and there is peculation that the other might be a joint application from Newberry, Wofford and Presbyterian.</p>
        <p>The conference expanded to 10 members last spring when Pfeiffer was accepted.</p>
        <p>LOOK YOU ^BEST /or the Holideus</p>
        <p>Cole,</p>
        <p>WING TIP</p>
        <p>SHOES</p>
        <p>Genuine Shell Cordovan Sizes 7-13 BAD Widths</p>
        <p>$22.95</p>
        <p>Larry's Shoe Store</p>
        <p>WAYS TO A PFRFEC'T FIT At 5 Points</p>
        <p>Rough Days In Store For 'iO Cage Giants</p>
        <p>By JACK CLARY</p>
        <p>Associated Press Sports Writer</p>
        <p>One or two games dont make a college basketball season but as far as some of the favorites are concerned, the first weekend was far from encouraging.</p>
        <p>Take Utah, one of the top choices to win the Skyline Conference title and wind up in the NCAAs postseason playoffs. The Uta*&amp;lt; have lost their first two games; and so have Purdues supposedly talent-ladn Boilermakers.</p>
        <p>Also wearing the look of surprise today are Kentucky (1-1), NYU (1-1), Wake Forest (1-1) and Villanova all of whom lost Saturday night after winning openers earlier last week.</p>
        <p>But still unshaken are Ohio State, the defending NCAA champ, and 1959 NIT winner Bradley. The Buckeyes play St. Louis tonight and face Army on Saturday.. Bradley, idle last Saturday night along with Ohio State, plays the Cal Aggies and tough ilt^ie Butler this week.</p>
        <p>Purdue found out It cant depend entirely on big man Terry Dischinger, losing to Penn State 63-59 Saturday night after being belted Friday by Pitt.</p>
        <p>Indiana, Big Ten co-favorite with Ohio State, has a 1-0 mark after an 80-53 victory over Indiana State. Things toughen quickly, though, for tonight the Hoosi-ers face Kansas State, then play Detroit Saturday. Kansas State, with games Friday and Saturday night in Los Angeles against CLA and Southern Cal, respectively, had to fight before subduing Texas A&amp;amp;M 69-64.</p>
        <p>Kansas plays St. John* in part of a doubleheader Friday night in New Yorks Madison Square Garden. The Redmen beat Army ^-49 Saturday. The Jay hawks also njeet Texas Tech tonight after an opening 86-M victory over Northwestern.</p>
        <p>In the other half of that New York twinbill, Cincinnati, with a 2-0 mark, play* Seton Hall, listed as a sleeper among the Easts Independents. The Bearcats, now minus All America Oscar Robertson, face Miami (Ohio) Tuesday night.</p>
        <p>Auburn (2-0) ha* a right to be cautious when it face* Florida State Saturday night. Florida State dumped Kentucky on its own floor, 63-68 Saturday night. Aubnrn has victories over two easy warmup foes.</p>
        <p>West Virginia, missing Its greaX Jerry West, won Its 44th consecutive hCHue game, 74-72 over WU-Uam St Mary in the last halfminute of overtime and plays The Citadel Tuesday. Wake Forest Friday and Duke on Saturday.</p>
        <p>Wake Forest lost to little Davidson 65-59 after an opening game victory and also must play Penn State Saturday night.</p>
        <p>Utah State showed it may be ready to take ovex* for Utaii in the Skyline after beating NYU In the final aix seconds 67-65. Buc Utah State has three more games on the road, meeting Detroit tonight, Nebraska Wednesday - and South Dakota State Friday.</p>
        <p>Utahs dreams of grandeur really went crashing Saturday Saturday night in a 59-56 loss to Stanford after being upset last Thursday by Loyola of Los Angeles. Villanova, after a victory, came back to earth when Buffalo pulled a 63-62 upset.</p>
        <p>Texas, the Southwest Conference champ, has a 77-54 victory over Howard Payne, and now must play Trinity (Tex.), Oklahoma City and Tulane this week.</p>
        <p>Also opening this week is North Carolina, a favorite for the At-'antlc Coast crown and Virginia Tech, figured to give West Virginia a tussle for the Southern Conference title.</p>
        <p>Elsewhere on Saturday night. Georgia Tech. the Sontheastem Conference favorite, walloped Furman 80-54. California made it 23 In a row at home, beating Santa Barbara 60-54, Dqke beat L8 80-74, St. Bonaventure won it* sec-cnd, whipping Murray State 92-39. Dayton beat LaMar Tech 73-51. Arkansas smacked Missouri 84-75, Oklahoma won over Minnesota 60-56, Washington whipped Brigham Young 74-54. North Carolina State conquered George Washington 88-68. and Kent State v-on the Midwestern Invitational title, beating Qemson 79-85.</p>
        <p>Third Conference VictoryECC Blossoms Late To Win 80-63</p>
        <p>By JOHNNY HUDSON Reflector Sports Editqr East Carolinas basketball team kept its fireworks bundled for some thirty-two minutes here Saturday night but skyrocketed to an 80-63 North State victory over Catawba with a fusilade in the final eight minutes of action.</p>
        <p>The Bucs, who gained a high rating in pre-season speculation, disapwlnted a iull-house Memorial Gymnasium following, estimated at 2,800, for the larger portion of the home opener but finished in a blaze of glory that brought the lackadaisical crowd to life, sending them home with victory oh the tip of their tongues.</p>
        <p>Catawba, the defending conference champions and listed among the tail-end clubs this season, had an upset within their grasp for most of the contest, outscrapplng and outhustl-</p>
        <p>ing the Pirates from the outset.</p>
        <p>Thanks to the shooting of Cotton Clayton, who scored 12 points in the first half, East Carolina was able to stick with the Indians in the first half.</p>
        <p>Paced by Jimmy Dew, a newcomer, and Roger Snow, Catawba employed a deliberate style of attack that produced dividends in the first half and kept East Carolina, as well a* It* fans, frustrated.</p>
        <p>After East Carolina moved out front 2-0, Catawba shot Into the lead and at several times held a point spread as large as five points.</p>
        <p>A spurt midway the first salf sa East Carolina score three straight buckets and jump into a 17-16 lead, Danny Bowen making the field goal that pushed EC ahead.</p>
        <p>Lacy West and Clayton banged away with a couple of two-pointers and East Carolina look</p>
        <p>ed ready to move, leading 22-18.</p>
        <p>Two field goals by reserve Tom Childress rallied Catawba into a 30-27 lead. Don Smith dropped a bucket just before the halftime buzzer, cutting the lead to 30-29.</p>
        <p>Action didnt change early 4n the second half, Catawte holding to Its bulldogglsh leisd most of the time. The scrappy Indians led by four points on several occasions and moved ahead 47-41 with 10 minutes remaining.</p>
        <p>A couple of fast breaks, Clayton leading the charge, moved East Carolina to within one point, 47-46. With eight minutes remaining. Bill Otte dumped a two-pointer to tic it at 51-61 and Clayton followed with a jump shot, giving East Carolina a 53-51 lead.</p>
        <p>The final seven minutes were clear sailing for East Carolina who won its third conference</p>
        <p>game in as many attempts. ECCs only defeat has been to non-conference The Citadel.</p>
        <p>Clayton and junior Charlie Lewis led the late barrage of baskets. It was also the same duo that came up with several ball thefts In the final minutes of play to enable East Carolina to win by a comfortable margin.</p>
        <p>Clayton, the sophomore ace, led the scoring with 28 points. It was high for an East Carolina player this season. Don Smith followed with 16 points and Charlie Lewis finished with 15.</p>
        <p>Jimmy Dow was top jnan for the losers with 15 points and Tom Childress supplied 12. Roger Snow also cracked double figures with 10 points.</p>
        <p>The victory gave East Carolina a game spread in conference standings. Other teams undefeated in the league are High Point, Lenoir Rhyne, Western Carolina and Appalachianall with one victory.</p>
        <p>Tonights action will find</p>
        <p>Guilford at Lenoir Rhyne and Appalachian at East Tennessee.</p>
        <p>Tomorrow night, East Carolina will play the second of its three-game home ^tand, host rg High Point. The Bucs arc scheduled to meet Lenoir Rhyne here Friday night.</p>
        <p>East Carolina FG FT PF Tf</p>
        <p>Smith ........... 6  4-4  4  16</p>
        <p>Lewis ........... 6  3-6  2  15</p>
        <p>Otte ............. 2  4-6  1  8</p>
        <p>Clayton ......... 11  6-7  4  28</p>
        <p>West ...;....... 2  2-3  4  6</p>
        <p>Bowen .......... 1  0-0  1  2</p>
        <p>Bowes ..........  0  5-7  3  5</p>
        <p>Adcock .......... 0  0-0  1  0</p>
        <p>Totals ........ 2P-  24-33  20  80</p>
        <p>FG FT PF TP</p>
        <p>Catawba</p>
        <p>Dew  .....  5</p>
        <p>Snow ............ 5</p>
        <p>Medford ......... 1</p>
        <p>F-orbis .........  2</p>
        <p>Wade ........... 0</p>
        <p>Moss ............ 0</p>
        <p>Garrison ........ 0</p>
        <p>Childress ........ 4</p>
        <p>Jcrfinson ......... 4</p>
        <p>Totals ........ 21</p>
        <p>Catawba ............ 30 3363</p>
        <p>East Carolina ......... 29  5180</p>
        <p>5-5</p>
        <p>0-1</p>
        <p>4-5</p>
        <p>1-2</p>
        <p>3-6 2-2 0-0 2-2</p>
        <p>4-5</p>
        <p>21-28 20</p>
        <p>15</p>
        <p>10</p>
        <p>6</p>
        <p>5</p>
        <p>3</p>
        <p>2</p>
        <p>0</p>
        <p>10</p>
        <p>12</p>
        <p>63</p>
        <p>CATAWBAS GUARD . . . A1 Johnson (31) tries to get away a shot over the outstretched arms of East Carolinas center Bill Otte (50). Pirates waiting around for the outcome are Benny Bowes (40), Danny Bowen (10) and Cotton Clayton (at far right). ECC won the conference tussle, 80-63.</p>
        <p>Chappel Ready To Return To Falling Wake Forest</p>
        <p>By THE ASSOCUTED PRESS</p>
        <p>To say that the Wake Forest basketball team needs Len Chap* pel is putting it mildly. Without the 8-8 senior, who led the Deacons in scoring last year. Wake Forest probably would be just another ball club.</p>
        <p>There was evidence of this Saturday when the Deacons were upset 65-59 by Davidson, with the injured Chappel not playing.</p>
        <p>Chappel, who was runner-up in scoring in the Atlantic Coast Conference last season with an average of 17.4 points a game, has been sidelined with a torn knee ligament suffered in pre - season drills. He hasnt worked out with the team since the cast was removed last Monday.</p>
        <p>He was expected to return to practice today, but whether hell be able to play in the next game Friday against West Virginia is not yet known.</p>
        <p>The lack of Chappel isnt the only thing that has hurt the Dea-cona Jerry Steele, who stands 6-8. also has been hampered by a knee injury and piyed only about four minutes against Davidson.</p>
        <p>The injuries to these two big men also hurt the Deacon* in the rebounding department, ol course.</p>
        <p>In other games Saturday involving ACC teams, Duke edged Louisiana State 80-74 In overtime. North Carolina State raced past George Washington 88-68, Maryland beat Virginia 57*52 in a conference game, and Clemson lost.</p>
        <p>79-65, to Kent State (Ohio) In the Kent tournament.</p>
        <p>The heralded North Carolina team makes its debut tonight, facing LSU at Chapel Hill.</p>
        <p>Never Before At Thi Price</p>
        <p>5 HOURS ONLY</p>
        <p>8 Hours only, Thursday, Dec. 8  12 to 8 p.m.</p>
        <p>Also MORSSIONAl ftSU OMONOGAAPN CAUMOAI wmoiNO WAKHtS</p>
        <p>The</p>
        <p>Perfeet</p>
        <p>Gift</p>
        <p>SIZiS FOI MfN, WOMEN,</p>
        <p>OYS a OIIU</p>
        <p>EXfANSiON lANO f I.M XEG $3.00 VALUE</p>
        <p>COMPAtf Wim ANY CHtONOftASN WATCHif (C9finf $24.95</p>
        <p>DRUGSTORE</p>
        <p>8 Hours Only  Thursday, Dec. 8  12 to 8 p.m. Poaittvely No Wlche To B Sold At This Price After Sale</p>
        <p>86 PROOF</p>
        <p>Straight</p>
        <p>BOURBON</p>
        <p>Whiskey</p>
        <p>0O.2S</p>
        <p>mmr</p>
        <p>*3.00 4/a quart</p>
        <p>TYIMMi MffaUNO COMTANV</p>
        <p>Ifs time to join the 1961 Christmai Club. Pick your Club Class and start saving: for happier apendingr next year.</p>
        <p>CLUB CLASSES</p>
        <p>81.60 each week ........I 5.60</p>
        <p>83.00  each  week ........ 100.00</p>
        <p>$3.00  eoch  week ........ 150.00</p>
        <p>$5.00  each  week ........ 850.00</p>
        <p>FmsT fsoERAL</p>
        <p>SAVINGS AND LOJJf 4^^CIATTOM</p>
        <p>' "  '-OP</p>
        <p>AydePa N* C.</p>
        <p>GrMmvUloi N. G</p>
        <p>.all,-</p>
        <pb facs="00087514_0008" />
        <p>PAGE EIGHTTHE DAILY REFLECTOIL GREENVILLE. N. C</p>
        <p>Monday. Dacelnbar 8. 1900</p>
        <p>Eagles Clinch NFL Title. Skins Lose</p>
        <p>The National Football League Championship game will match Philadelphias streaking Eagies agaTst Baltimore or Green Bay or San Francisco or Chicago or Detroit-</p>
        <p>That was the situation today, with only two weeks left In the regular season.</p>
        <p>The Eagles clinched their first Eastern Conference title since 1949 by whipping the St. Louis Cardinals 2(H) Sunday for their ninth co:isecutive triumph.</p>
        <p>The Baltimore Colts, seeking to gain a playoff berth for an unprecedented third consecutive time, were beaten by the Detroit Lions 29-15 when Earl Morral con</p>
        <p>nected with Jim Gibbons for a 65-yard touchdown pass on the Uast play of the game.</p>
        <p>I The loss dropped Baltimore intc a three-way tie for first place in the Western Division with Green  Bay and San Francisco, all with 6-4 records, while Chicago (5-4-1) and Detroit (5-5) remained solidly in contention.</p>
        <p>I The Packers, getting a 23-point l&amp;gt;erformance from Paul Hornung that gave him 152 for the campaign and broke Don Hutsons 18-year-old one-season scoring record, walloped the Bears 41-13. The 49ers moved into position by blasting Los Angeles 23-7 before a</p>
        <p>crowd of 77.254.</p>
        <p>The Cleveland Browns grabbed the runner-up spot in the East with a 27-16 victory over Washington while winless Dallas tied the New York Giants 31-Sl.</p>
        <p>Norm Van Brocklin, a 34-year-old veteran who was  rookie with Los Angeles when Philadelphia last captured the Eiastem championship, passed for two touchdowns and Bobby Walston kicked a pair of field goals for the Eagles (9-1). Van Brocklin chit Pete Retzlaff with a 22-yarder, then pitched a 25-jFtrder to Tom McDonald after the Cards (5-5-1) had scored on Mai Hammacks</p>
        <p>two-yard plunge in the third period.</p>
        <p>The Colt* scored what appeared to be the winning touchdown with 14 seconds left when Johnny Uni-tas. who had previously unleashed an 80-yard TD heave to Lenny Moore, fired a 34-yard scoring aerial to the fleet halfback for a 15-13* lead. But Morrall, on the bench for the first three periods, completed a 17-point fourth-quarter surge for Detroit by whipping the clincher to Gibbons following the klckoff.</p>
        <p>Homung carried the Packers to their overwhelming triumph against the Bears by scoring</p>
        <p>twice on a 10-yard ryn and a 17-yard pass from Bart Starr, kicking two field goals and five conversions while eclipsing the NFL scoring record set by Green Bay's ButAm in 1942. Chicagos touch-Howns came on a 19-yard Ed Brown to Willie Dewveall pass and a 20-yard toss from Zeke Bra|kowski to Jim Dooley.</p>
        <p>The 49ers. using the double wing offense that proved effective in last weeks iritunph over Baltimore, built a commanding 10-0 halfUme lead over Los Angeles (3-6-1) on a 10-yard scoring jaunt by C. R. Roberts and the first of three field goals by Tommy Davis.</p>
        <p>A 65-yard TD strike from John Brodie to Clyde Conner rounded out San Franciscos scoring before the Rams rallied on Prank Ryans two-yard sneak.</p>
        <p>Mt Plum had his first pass Intercepted on his 196th aerial this season, but his three touchdown flips brought the Browns (6-3-1) from behind twice against the cellar-dwelling P.. * :kins (1-7-2</p>
        <p>Eddie LeBarons nine yard touchdown toss to Bill Howton In the final period gave the Cowboys their Uc with the Giants (5-3-2) after L. G. Dupre scored three TDs, two on LeBaron passes, to keep Dallas within range.</p>
        <p>COLLEGE SCORES</p>
        <p>By THE ASSOCIATED PRESS Sundays Games Xavier (Ohio) 106 Bellarmlne</p>
        <p>69</p>
        <p>St. Marys (Minn.) 70 St. Nor-bert (Wis* 56</p>
        <p>Saturdays Games</p>
        <p>EAST</p>
        <p>Canisius 70, Bowlin Green 52 Penn State 63, Purdue 39 Penn 84, VMI 80 Buffalo 63. ViUanova 62 Templyc 73. Manhattan 55 Navy 69. Pitt 63 Niagura 83, Assumption (Ont.)</p>
        <p>17</p>
        <p>Seton Hall 81, Pairleigh Dickin-</p>
        <p>South Carolina Wins Via Air</p>
        <p>By KEN ALYTA</p>
        <p>CHARLOTTE (APiThe story of South Carolinas 19-3 Shrine Bowl football victory here Saturday was written in the air for all the 23,000 spectators to see.</p>
        <p>Coach John McKissicks Palmetto forces scored on passes three times and five times they intercepted tosses by the North Carolina team that was supposed to hold the advantage in the passing department.</p>
        <p>A pair of quarterbacks and two ends combined for the scoring plays that gave South Carolina its eighth victory in the 24-game series against 12 North Carolina triumphs and four ties.</p>
        <p>It was the first time since 1944 that North Carolina had failed to score a tcmchdown and only once 127-7 in 1954) has a Tar Heel team been more thoroughly trimmed.</p>
        <p>As McKlssick, Summcrville High School coach, summed it up. My boys didnt let mistakes and breaks get them down, but just kept coming. We kept getting better all the time.</p>
        <p>The game started ominously for South Carolina, with three first period fumbles. One l^d to the lone Tar Heel tally, a field goal from the 25-yard line by Elkin end Steve Holloway.</p>
        <p>But after that the Palmetto forces took charge and won hand-8(mely. They scored in each of the first three periods.</p>
        <p>Quarterback Jim Tom Oliver of Orangeburg threw two touchdown passes and another quarterback, Jerry Priestley of Nwth Augusta, tossed one.</p>
        <p>Walter Goldman of Greenwood eaught two of them, one for 5 yards and another for 10, Goldman, nc^ on the original squad list anneuiuied three weeks ago, was an added starter. He Joined the team a week ago at the start t praetiee.</p>
        <p>The third touchdown came on a 14-yard pass play, Oliver to Alton Buddin. end from Greenville, who ran the last 27 yards after the tatch.</p>
        <p>Priastley was voted the award as the outstanding back by a fecial Shrine committee. He completed four of his six passes for 4? ytrds and a touchdown and ran 8 times for 21 yards.</p>
        <p>Tommy Brawley, 219-pound tackle from Mooresvllle, was voted the top lineman.</p>
        <p>South Carolina rolled up a total of 307 yards against 147 and had a 17-8 edge in first downs. Five lost fumble.5 slowed the Palmetto attack, but they made up for those lapses with five interceptions, two by John Johnson of Winnsboro,</p>
        <p>The top ball carriers were Billy Ward of Columbia, 49 yards in 13 carries; Mike Derrick of West Columbia, 41 in 11, and Gene Isen-hour of Hickory, 41 in 13.</p>
        <p>son 78 LaSalle 65. Albright 62 Princeton 69, Lafayette 50 Rhode Island 78, Brown 70 St. Bonaventure 92, Murray (Ky) 39</p>
        <p>Boston Colleye 83. Fairfield 70 St. Johns 69, Army 49 Colyate 84, Cornell 80 (Double overtime)</p>
        <p>Utah State 67, NYU 65 Holy Cross 79, Harvard 66 St. Michaels (Vt) 78, Dart-nriouth 71 Yale 63, Connecticut 55 Bucknell 58, Rutyers 55 Deleware 60, Lehlyh 43 Duquesne 96, St. Francis (Pa)</p>
        <p>68</p>
        <p>Providence 58, Assump tion (Mass) 42 New Hampshire 83, Tufts 78 Maine 75, Bates 52 Muhlenbery 83, Scranton 77 SOUTH</p>
        <p>Mississippi 79, New Orleans Loyola 69 Georvetown (DC; 112, Loyola (Md) 71</p>
        <p>Fullmer Looking American Loop Given Go</p>
        <p>By PATRICK MCNULTY Associated Press Sports Writer LOS ANGELES (AP)  NBA nriiddlewelght champion Gent Fulmer set his sights on 01 Archie Moores version of the Hght-heavywelght title after turning back Sugar Ray Robinsons gallant bid to recapture the 160-round crown for the sixth time.</p>
        <p>Robinson, described by his manage as heartfco'oken over Saturday nights draw with Fullmer, was considerinf hanging up his gloves.</p>
        <p>Ive always wanted to try Moore on for size and now It looks as If Ill get my chance, said Fullmer,</p>
        <p>Mo&amp;lt;h*c said, After all, Fullmer should like to fight me. Hed be</p>
        <p>MissLssippi State 77, SE Louisi-; getting a shot a- a really old man.</p>
        <p>Houses worm up to Shell</p>
        <p>QUALITY</p>
        <p>OIL COMPANY</p>
        <p>OrMOYUkt. H. O.</p>
        <p>anna 55 Auburn 66, Huntinydon 44 Miami (Fla) 93, Tampa 64 Maryland 57. Virginia 52 Duke 80, LSU 74 (ot)</p>
        <p>Davidson 65, Wake Forest 59 Georgia 89, Georgia Southern 64</p>
        <p>Citadel 92. Richmond 78 West Virginia 74, William &amp;amp; Mary 72 (ot)</p>
        <p>NC State 88, George Washington 68</p>
        <p>Tennessee 75. Michigan 64 Georgia Tech 80, Furman 54 Florida State 63. Kentucky 58 SE Oklahoma 77, Louisiana lech 61</p>
        <p>Tennessee Tech 99, Chattanooga</p>
        <p>51</p>
        <p>MIDWEST</p>
        <p>Arkansas .84, Missouri 75 Marquette 107, North Dakota 68 St. Louis 76. Qalfornia Aggies 24</p>
        <p>Iowa 83, Evansville 71 Kansas State 69, Texas A A M</p>
        <p>64</p>
        <p>Oklahoma 60. Minnesota 56 Cincinnati 85, WestemSi Dayton 73, Lamar Tech 51 Kansas 86. Northwestern 69 Marshall 78, Marietta 69 Michigan State 77, Butler 71 (ot)</p>
        <p>Indiana 80, Indiana State 53 Wisconsin 80, Air PM-ce 67 Drake 100, Southern Illinois 53 BaU State 71, Baldwin-Wallace</p>
        <p>36</p>
        <p>Depauw 97, Denison 52 Detroit 103, South Dakota State</p>
        <p>76</p>
        <p>Miami (Ohio) 99, Ashland (Ohio) 58 Ohio University 87, Youngstown</p>
        <p>76</p>
        <p>SOUTHWEST Rice 71. Trinity (Tex) 7 New Mexico 66, Hamline 53 Texas 77. Howard Payne 54</p>
        <p>Moore, Fullmer and Fullmers manager, Marv Jenson, met at a party after the Utah billy goat's battle with Robinson and tentatively agreed to terms.</p>
        <p>Matchmaker George Pamasus, who staged the FuUmer-Robinsoo rubber match, left today for San Diego to finalize the deal with Moore, who Insists on the championss share of the gate.</p>
        <p>Parnassus said he hopes to' stage the Pullmer-Moore battle, if plans work out. in April outdoors in Memorial Coliseum.</p>
        <p>For their savage war Saturday. Fullmer took 40 per cent and Robinson 20 per cent of the gross gate of $122,584 plus $100,000 for television.</p>
        <p>Fullmer, relying on bull-like rushes to wear down Robinson, guarded his jaw wiUi his gloves as If he had a Jowlful of jewels. Robinson tried to steal the jewels with some nifty combinations. Several times he shook the charging champion and in the savage 11th round he popped FuUm^ wlth two right hand leads that would have knocked the head off a marble statue. But Fullmer merely blinked and flurried back.</p>
        <p>The referee scared the fight tor Robinson 11 to 4 under CaL ifomia'a scoring system that gives the winner of a round one cr more points up to five and the loser nwie. However, one - Judge voted for Fullmer 9-5 and U othM* Judge called it a draw, 8-8.</p>
        <p>Fight Reeetts</p>
        <p>Los Angeles  Gene Fullmer. 159, West Jordan, Utah, and Ray Robinson, 158H, New York, drew (15). (Fullmer retained NBA world middleweight title).</p>
        <p>Havana  Baby Linares, 1584, Havana, outpointed Mvx^elino Gonzalez, 158, Havana (10).</p>
        <p>By JOE REICHLER</p>
        <p>Associated Press Sports Writer</p>
        <p>ST. LOUIS, Mo. (AP)  The American League has been given the green light to go to Los Angeles next yearif.</p>
        <p>The big if is that the leagues 10th club must play its home games In the Rose Bowl in Pasadena.</p>
        <p>That is the stipulatioB Dodger owner Walter OMalley and National League President Warren Giles gave to a committee to present'to the American League at todays meeting.</p>
        <p>A counter proposal that W(Hild allow the new Los Angeles club to play its home games either Jn the Coliseum or in Wrigley Field was rejected by OMalley.</p>
        <p>We thought enough of the Rose Bowl to survey It so I dont think there is any reason why they shouldnt give it some consideration, said OMalley.</p>
        <p>A committee of club representatives met in the commissioners</p>
        <p>suite late Sunday night in an 11th-hour attempt to reconcile differences between the two leagues and pave the way for the American Leagues expanslcm to 10 clubs in 1961. Giles and Joe Cronin, president of the American League attended the special conference.</p>
        <p>A member of the committee, weary after the four-hour session that lasted into the early morning hours, told the Associated Press;</p>
        <p>The proposition has been made. Now it is up to the American League and the group selected to operate the franchise."</p>
        <p>Cronin and Giles appeared optimistic.</p>
        <p>Im confident that something win be worked out," said Giles. It may not make everybody happy. but it wont be a fight."</p>
        <p>The Rose Bowl is a football stadium that seats 100,000. It Is about 15 miles from Chavez Ra vine, where OMalley is building</p>
        <p>LR Headed To NIA Bowl With Humboldt</p>
        <p>HICKORY, N.C. (AP)  Coach took a 10-game winning streak in-</p>
        <p>Clarenct Stasavich says hell have to patch and pamper his Lenoir Rhyn* Beas to bring the team to full playing strength for 'the NAIA Holiday Bowl game Saturday.</p>
        <p>Lenoir Rhyne left for St. Petersburg. Fla., today for a week of practice before meeting the NAIA Westehi champions. Humboldt State of California.</p>
        <p>The Bears were awarded the Eastern NAIA championship Stti-urday after a game with Northern Michigan ended in a 20-20 tie. The UUe was awarded on the basis of yardage gained. The Bears gained 294 yards compared with 268 for Northern Michigan.</p>
        <p>Humboldt State beat Whitworth College of Spokane, Wash., at Eureka. Calif., Saturday, 13-7, in tffe Western playoff.</p>
        <p>Stasavich says he has not scouted Humboldt State but that both teams wUl exchange films in St. Petersburg.</p>
        <p>Lenoir Rhyne won 10 straight games last season before l(lng, 20-7, to Texas A A I at St. Petersburg a year ago. The Bears also</p>
        <p>to Saturdays game.</p>
        <p>Stasavich said his team lacks depth beciiuse of injuries and needs rapid recuperation before the Holiday Bowl game.</p>
        <p>I think we can beat them if we can get our kids well." he said. We had the same situation last year but we had two weeks to work things out.</p>
        <p>Stasavifh said the Bears star tailback, Lee Fanner, second team Associated Press Little All-America. was slowed to half speed Saturday because of Injuries.</p>
        <p>a stadium for his Dodgers. The park is expected to be completed sometime in 1962, The Dodgers now use the Coliseum.</p>
        <p>The American League is not ,completely happy with OMalley's^ compromise proposal. Swne owners feel the Rose Bowl is not suitable for major league baseball.</p>
        <p>Four groups are bidding for the franchise. The successful one wl be a group that Includes Gene Autry and Bobby Reynolds, former Stanfm-d tackle. Kenyon Brown, Los Angeles TV executive who formerly headed the group, will piay a major role in the new operation.</p>
        <p>The American League has asked OMalley to meet with Autry and Reynolds today. The Dodger owner indicated he would.</p>
        <p>The type of organization with which I will have to compete is more important than the money Involved (compensation), OMalley said. This group (Autrys) if not objectionable."</p>
        <p>Some American Leaguers still held out hope that the National League might go along with the 9-team proposal and an Inter-league schedule.</p>
        <p>I wouldnt bet on it. said one. butn know that O'Malley has been picking up votes here and there. I dont think he has enough, however.</p>
        <p>There was a report that the American League, at its meeting, will approve the sale of the Kansas City club to a group of Kansas Citlans. The sale has not been announced.</p>
        <p>RARE</p>
        <p>Biy Ob The Bl All Work OwanuitMi ProMpt Expert Scrvlee At MMIsrate PHesa.</p>
        <p>Saads Shoe Shop</p>
        <p>lU Qraiids Ava PL t-12 Wt GNe King Kora BUaipa</p>
        <p>$</p>
        <p>PINT</p>
        <p>4/8 QT.</p>
        <p>UPIRLATIVB BLENDED WHISKEY, IS PROOP. fSB IRAIN NEUTRAL SPIRITS, MELROSE DISTILLERS CO., NEW YORK</p>
        <p>T</p>
        <p>still shopping?</p>
        <p>The easy way to take can of so many names on your Christmas shopping listan eiectric gift! Your electric dealer has a variety of small electric gifti that will bring better living the year 'round-toasters, fry pant, coffee makers, waflfit bikirt, mlxirii blenders, to mention a few. This Christmai, give better lectricilly.   with | gift that gives pleasure for years.</p>
        <p>Greenville Utilities Commission</p>
        <p>ScrYtc* It Our Mott ImporUnt Frodutt</p>
        <p>ELECTRICITY... best buy for better living</p>
        <p>1</p>
        <p>You are invited to attend The 3rd Annual</p>
        <p>Social Security Forum</p>
        <p>Court Room-3rd Floor-City Hall</p>
        <p>Greenville, N. C.</p>
        <p>Tuesday, December 6, 1960</p>
        <p>2:30 p.m. and 7:30 p.m.</p>
        <p>Sponsored by:</p>
        <p>WACHOVIA</p>
        <p>BANK AND TRUST COMPANY</p>
        <p>(Formerly Guaranty Bank and Trust Company)</p>
        <p>Member Federtl DeputU Inturtuice Corporttion # Membei t ederal Reierve Syitem</p>
        <p>Im</p>
        <pb facs="00087514_0009" />
        <p>Monday, December 5, 1960</p>
        <p>THE DJ^ILY REFLECTOR, GREENVILLE. N. C</p>
        <p>^AGE NINE</p>
        <p>AMES KEENES New Hpstdrick Novi</p>
        <p>mmmmrnm.</p>
        <p>CHAPTER 33</p>
        <p>Betty Singer was sitting on. one of the hard benches in the caboose when Ben Holliday walked in. Smoke still remained in the cc^ch, and Holliday opened the Other door to induce some .ah* circularon.  ,</p>
        <p>Your father and biother are gone. he told her.</p>
        <p>I don't care now.</p>
        <p>Ho shrugged. All right. What are ^ou going to do now?</p>
        <p>Go where Jim Bender goes, she said. Ive waited too long, M-. :-romday.</p>
        <p>It makes sense. Im not going to ask you anything about your father or Carl. But Ive got to tell ou 'hat Im going to do. Von dont have to tell me. sho^ .ia d softly. I know.</p>
        <p>Te seemed relieved about it: he didnt relsh the idea of telling her he was going to kill her brother, Im not going to take Jim Bender with me. Holliday said. I dont want anything,to .tand between you Net aoitttibg like this. The railroad will break your father, but Jim l^iid?r doesn't have to be a part of it.'!</p>
        <p>Thank you -for that. She stood up and tried to brush the soot from her dress but only succeeded in smearing it. What makes a man want to own everything, Mr. HoUiday?</p>
        <p>I dont know. Cant you answer that? Dont you know</p>
        <p>your own father?</p>
        <p>No, and I'm sure he doesnt know himself. He has to have things for no other reason than }ust wanting them.*' </p>
        <p>Holliday turned to the door Its Carl Im after, Betty. He [kled Skinner.</p>
        <p>I Dont go after him alone. she warned, then pressed her lips tightly together; it was the only ! advice she was going to give him. He watied a moment longer, then stepped down from the caboose and w^alked rapidly toward Colonel Dawsons position. He was being a fool, he told himself, but he was going to do this alone, without Bender or Sergeant Du-Joise.</p>
        <p>It was railroad business, strictly.</p>
        <p>a half hour, he said. Theres a coach on the tail end of it Damn it. Julius said. Not even time for a man to get his supper.</p>
        <p>Father, you ought to make up your mind, Adm said. Finrt you fuss because there wont be a train, and now youre</p>
        <p>Television Log</p>
        <p>WNCTCh. 9</p>
        <p>MONDAY</p>
        <p>Adam Holliday stepped down fromthe coach at Dodge City, then turned to help his father with the suitcases. Julius Holliday wore a frown and a wrinkled suit and ian air of impatience. He said, Check to see ,if theres a train south. Its too much to hope for. but check anyway. Ill sit in the shade and wait for you.</p>
        <p>I Adam carried the suitcases ov-jer to one of the benches, and Julius Holliday lowered his bulk with a sigh. He checked his watch against the depot agents time while he waited, then Adam came back.</p>
        <p>I A freight Is leaving in about</p>
        <p>PHE ANDGUDYS INTROUBILBREIIK BANKTO BllYGIFT!</p>
        <p>Dont tell me what Im doing, Julius Holliday said. I was a fool to come along in the first place."</p>
        <p>You insisted. Father.</p>
        <p>Who can argue with a lawyer. Julius said, then stood up. let's go to the coach. It may be cooler there. He hefted one of the suitcases. Wouldnt you think that it would cool off at sundown? They walked along the siding, cinders crunching beneath their feet, and Julius spoke in a grumbling voice. Why the devil !Ben couldnt meet us is beyond jme.</p>
        <p>You didnt wire that you were coming, Adam said. I wanted to, but you said no.</p>
        <p>They found the train, loaded with army horses. The coach was next to the caboose, and when they drew near, Anna Neubauer and her father stepped away from the door so they could step up. Julius hauled himself to the platform, then turned to take the bags from his son. Anna Neubauer looked at Adam Holliday, then stepped forward and  touched  him on the arm.</p>
        <p>Why  youre  Bens  brother,</p>
        <p>arent you?</p>
        <p>Yes, Adam said, smiling. And hello, hello. Any friend of Bens is a friend of mine. But he never told me about you. Hes been busy, Anna said. Adam  nodded  and  continued</p>
        <p>to smile. And I dont blame him. Allow me to introduce my father,  Mr. Julius  Holliday.</p>
        <p>Miss, ah</p>
        <p>FOR TONIGHFS BEST, STAY WITH CBS </p>
        <p>6*45</p>
        <p>A rewarding roundup of the day's top news.</p>
        <p>r  TO  tCLLTNE  TRUTH.  Fibbing  If  fun  on  this</p>
        <p>popular panel game, with host Bud Col Iyer.</p>
        <p>8:00 PETE &amp;amp; GLADYS</p>
        <p>They have to break the piggy bank when a "revenge** gift ^ backfires. Be sure to get on this marry-go-round of laughs!</p>
        <p>9.#111 THE DANNYTNOMAS SHOW. Danny gets UU his boss to fill his own dreaded dental date.</p>
        <p>9*30  OiHFFITH  SHOW.  Justice  Andy</p>
        <p>presides at a shotgun wedding-in reverse!</p>
        <p>10H)0 HENNESEY. An aged nag puts the betting</p>
        <p>oddsawash at Jackie Cooper's Naval hospital</p>
        <p>WNCT CHANNEL 9</p>
        <p>6:00Popeye</p>
        <p>5:30Capt. Gallant, ABC 6:00Deputy Dawg 6:30{Your Esso Reporter 6:40weather 6:45Doug Edwards, CBS 7:00The Plintstones, ABC 7:30To Tell the Truth, CBS 8:00The Rebel, ABC 9:00Danny Thomas. CBS 9:30Andy Grifith, CBS 10:00Hennesey, CBS 10:30Peter Gunn, ABC 11:00Weather 11:05Carolina News 11:10News and Sports 11:20Just Off Broadway TUESDAY</p>
        <p>6:30Carolina Today .......</p>
        <p>8:00Morning News, CBS 8:15Capt. Kangaroo, CBS 9:00Morning News, CBS 9:15Our Gang 9:30World of Science 10:00December Bride. CBS 10:30Video Village, CBS 11:001 Love Lucy, CBS 11:30Clear Horizons, CBS 12:00-Debnam Views the News 12:15Farm News 12:25Weather</p>
        <p>12:35Search For Tomorrow, CBS</p>
        <p>12:45Guiding Light, CBS 1:00Love of Life, CBS 1:30As the World Turns, CBS 2:00Pull Circle, CBS 2:30Linkletters Party, CBS 3:00Mr. and Mrs. North 3:30Verdict is Yours, CBS 4:00Brighter Day, CBS 4:15Secret storm, CBS 4:30Edge of Night, CBS 6:00Popeye 5:30Rin Tin Tin, ABC 6:00Huckleberry Hound 6:30Your Esso Reporter</p>
        <p>Anna Neubauer." She intro-duuced her father, who shook hands self-conscioualy.</p>
        <p>Then Julius said, Cant we sit down?</p>
        <p>I hope youre going south? Adam said, taking Annas arm to help her aboard.</p>
        <p>Oh, yes, she said Weve been waiting for the train to get back.  ,</p>
        <p>JuUus. who w'as finding his i seat, said, Wheres it been?</p>
        <p>To the end of the track, Anna told him. Bens there now. Theyre fighting the Indians  Julius stared for a moment, then shrugged it off as foolish talk. But Adam took it more seriously. Do^ you mean that? I cant believe it. He sat beside her with the assurance that he would be welcome. Ben doesnt know anything about fighting Indians.</p>
        <p>I think hes learning quickly, she said, smiling at him. Dont you have any confidence in Ben? Its not a matter of confidence, Julius said flatly. You cant fight Indians and run a railroad too.</p>
        <p>The conductor came into the</p>
        <p>plans with Jim Bender or Sergeant DuJoise. Instead, he sent Bender along with the work train, and the Frenchman was left in charge of the end of track camp. The train pulled out for the main yard shortly after sundown, and the army left to make a wide four-day sweep to keep the Indians under constant eye. Holliday sat in the cook tent and waited for the camp to settle down for the night before leaving.</p>
        <p>There was no definite plan in his mind when he quietly saddled a horse and eased out of camp. He took a pistol with him and some spare shells, and a determination to finish the nasty job of tracking down Carl Singer.*</p>
        <p>6:40Weather 6:45Doug Edwards, CBS 7:00Route 66, CBS 8:00Rifleman, ABC 8:30Wyatt Earp, ABC 9:00Donna Reed, ABC 9:30Red Skelton, CBS 10:00Garry Moore, CBS</p>
        <p>11:00Weather 11:05Carlina News 11:10News and Sports 11:20Ride Kelly Ride</p>
        <p>WITN Ch. 7</p>
        <p>DEEDS</p>
        <p>MONDAY</p>
        <p>7:00Manhunt 7:30Riverboat. NBC 8:30Wells Fargo, NBC 9:00Klondike, NBC 9:30Seahunt</p>
        <p>10:00Barbara Stanwyck Theater, NBC</p>
        <p>10:30Jackpot Bowling, NBC 11:00News, Weather, Sports 11:15Jack Paar Show, NBC  TUESDAY 6:30Continental Classroom, NBC</p>
        <p>7:00Dave Garroway, NBC 9:00In School Television 9:30Fun Time 10:00-.Dough Re Mi, NBC 10:30Play Your Hunch, NBC 11:00Price Is Right. NBC 11:30Concentration, NBC 12:00Truth or Consequences, NBC</p>
        <p>12:30It Could Be You. NBC 12:55NBC News Day Report, NBC 1:00Unaovered 1:30Award Theater 2:00Jan Murray Show, NBC 2:30Loretta Young Theater, NBC</p>
        <p>3:00Young Dr. Malone, NBC 3:30From These Roots, NBC 4:00Make Room for Daddy, NBC</p>
        <p>4:30Heres Hollywood, NpC 5:00Three Stooges 5:30Cartoon Time 6:00Big Mac Show 6:30Channel 7 Reporter 6:40Weatherwise 6:45NBC News, NBC 7:00U.S. Marshal 7:30Laramie, NBC 8:30Alfred Hitchcock, NBC 9:00Thriller, NBC 10:00Roaring 20s, ABC 11:00News. Weather. Sports 11:15Jack Paar Show, NBC</p>
        <p>James Whitfield, al to Jesse Williams, 1 $10.00 Jesse J, Jojmtr, al to Don O. Bryan Jr., al $10.00 J. R. 01ads&amp;lt;m, al to Cape Fear Wood Corp. $10.00 J. T. Clark, al to Jadie Tenneth Clark $10.00 R. S. Smith to Charlotte Flanagan $10.00 Greenville Builders. Inc to Marshall Jr. Wiliiams $10.00 Nina E. Morris to Sylvester Morris, al $10.00</p>
        <p>Abbott M. McWhorter, al to HU-ton L. Tetterton, al $10.00 Earl Spain, al to Charlie William Mills, al $10.00 D. W. Branch, al to George Lee Elks, al $10.00 James V. Piet, al to E. William Kaegehein, al $10.00 R. H. Heath, al to Richard E. Hardee, al $10.00 Mack V. Sawyer Jr, al to Char-le.s Day Peaden, al $10.00 North Side Lumber Co. to RaliA</p>
        <p>J. Riggs, al $10.00 Frank Hart, al timber! to seaboard Timber Corp. $10.00 E. H. Oairis, al (timbtt) to J. A. Turlington $10.00 Prank Johnson to Woodrow Vines, al $10.00 Roger B. Johnson, al to Sarah C. Cobb $10.00 William Walter Buck, al to T. Harvey Branch. 1 $10.00 Fred Simpler, al to H. E. Beech, al $10.00</p>
        <p>Jesse O. Clemons, al to Luke H. Lee, al $10.00 Guaranty Bank &amp;amp; Trust Co. to Wachovia Bank Trust Co,</p>
        <p>L. T, Artis, al to Moses Joyner, al $10.00 Senie McCauley to Arletha Hardison $10.00 James D. Dotson, al by Tr.) to Jessie M. Williams $5,900.00</p>
        <p>Bituminous coal mining in the United States is more than 90 percent mechanized.</p>
        <p>Legal Notices</p>
        <p>NOTICE NORTH CAROLINA PITT COUNTY</p>
        <p>C. C. Riddick and wife, Mabel Ann Riddick, WilUe Manning and wife. Hilda Manning, W, R. Powell and wife, Luella Powell. Ruth Riddick Whlteley, Wachovia Bank and Trust Comany, Successor to Guaranty Bank and Trust Company, Admlni.strator of the Estate of Annie Elizabeth Riddick</p>
        <p>vs.</p>
        <p>William T. Whiteley</p>
        <p>thence North 634 West 76 poles to an iron stake in Blounts line, thence with Blounts line 53 V West 69 poles to the road, thence with road South 54 East 12 pole.s and 8 links to beginning containing 25 acres more or less.</p>
        <p>line to S. M. Jones line to Grlndla Creek, and thence Southerly to the beginning, containing 21 acres more or les-s.</p>
        <p>Fourth Traci: Beginnlnt at a comer Lot No. 1, thence North 69 4 East 47 poles to a white oak, thence South 3 West 82 poles,</p>
        <p>I hence North 87 West 86 poles to Houses corner, thence North I West 40 poles, thence North 88 i East 50 poles, thence North 2*4 East 19 poles to the beginning, counting by estimation 27*2 acres more or less, known as Lot No, 3 share and the Billie James interest in her father W. J. Teels estate.</p>
        <p>Fifth Tract: A certain parcel of land lying and being in Bethel j Township. Pitt County, and being Farm No. 4 described and con-* talned in a certain map by John L. Kennedy. C. E., which map is registered in Pitt County Registry in Plat Book 2, page reference being made for better description, containing 7 acres more or less.</p>
        <p>The five tracts of land comprise what is commonly known and designated a.s the W. C,^ Riddick and wife, Annie Elizabeth Riddick, homeplace.</p>
        <p>The la.st and highe.st bidder will be required to deposit with the undersigned commissioner 10^ of Ihe price bid. at said sale.</p>
        <p>This 28th day of November. 1960. HENRY A JOHNSON Commissioner 5-12-19-26</p>
        <p>Third Tract: Beginning at said fork road and running with said road toward Parmele to Lot No. 7. Bullock line, thence Southerly with lot and to Jc^n A. Mannings line, thence Westerly with Manning's</p>
        <p>Peanut Brittle</p>
        <p>Dieners Bakery</p>
        <p>815 Dickinson Ave. PL 2-52S1</p>
        <p>PLANS FOR PRAYER</p>
        <p>A trap has been baited for Ben Holliday Continue the story to a ciiinax tomorrow.</p>
        <p>WHEATON, 111. (AP)  'Die National Association of Evangelicals is distributing special worship materials for use in churches next Feb. 17 on World Day of Prayer.</p>
        <p>Lookout Mountain, with a prowlike summit overlooking Chattanooga, Tenn., is 75 miles long.</p>
        <p>Under and by virtue of that certain Order of Sale and Judgment signed by D. T. House, Clerk Superior Court, on the 28th day of November, 1960, the undersigned commissioner will on Fri-! day, December 30, 1960 at 11 a.m. on the lands hereinafter described, offer for sale at public auction to the highest bidder for cash the following described lands:</p>
        <p>First Tract: One piece or parcel of land known as the land of W. C, Riddick and Inherited by him from his mother, Annie Riddick Estate, containing by Estimation 22*2 acres more or less, and bounded by the land.s of M. O. Blount on both sides, and being the W. C. Riddick undivided interest in said estate.</p>
        <p>Second Tract; Being a part of; the Grey Blount tract of land,: beginning at a fork of the road between the old Blount Residence and John A. Manning corner, and running North 37* a East 74 poles to an Iron stake on side of road.</p>
        <p>HEAT WITH HAYNES</p>
        <p>WE GIVE</p>
        <p>GOLD BOND STAMPS!</p>
        <p>Havngs</p>
        <p>, penoieuM COUP.</p>
        <p>S)C4'uua^ -&amp;amp;ie PL 8-1277 Vlllttiiliita</p>
        <p>coach and walked toward them he had a fare book in hand and Julius Holliday seemed insulted i by it. Im Julius Holliday, a Ijoard member of this line. he said. Dont you have passes?</p>
        <p>Cant pay the bills with passes, the conductor said dryly. Mr. Holliday, ah, Ben, that is. did away with those the first week. Thatll be four eighty-five apiece.</p>
        <p>Remind me to talk to Ben about this, Julius said, and paid up. What a way to run a railroad! Well get it all straightened out at the board meeting. Even if we have to elect a new chairman. Now. whats pleasant to talk about? I understand its a long ride.</p>
        <p>Yours for a Song!</p>
        <p>Kentucky</p>
        <p>Bourbon</p>
        <p>Ben Holliday did not discuss his</p>
        <p>BE SURE TO SEE OUR WIDE VARIETY OF BEAUTIFUL CABINET MODELS</p>
        <p>SINGER SEWING CENTER</p>
        <p>HKADQUARTKRS POR ALL YOUR SEWINQ AND FLOOR CARS NKKDft</p>
        <p>(LlttM Ui rmtr iwM kok unMr StNOtS SEWINQ MACHINE COMPANV)</p>
        <p>412 Evans St.. Greenville, N. C.</p>
        <p>Phone PL 3-4098</p>
        <p>lAAw  a-aH aM Mr-aat an aaa Bmv PayaiaM Ria</p>
        <p>T S'nUUGHT KENTUCKY BOUBBON</p>
        <p>4</p>
        <p>ncietr</p>
        <p>diiieeed accoiiUn^</p>
        <p>/&amp;lt;yMe^neAt^AadlicnA</p>
        <p>DtSmtCD ft BOTTLED Bt ANCIENT AGE OISTILLINC CO. FRANKFORT. KENTUCKY</p>
        <p>STRAIGHT KENTUCKY BOURBON WHISKEY. 86 PROOF ANCIENT AGE DISTILLING CO, FRANKFORT, KY.</p>
        <p> WokBt you to music^automaticollyi</p>
        <p> Turns itsolf off~quittly</p>
        <p> DBptndabIt 6-E otocfric clock</p>
        <p> PowBrful G-E Dynopowtr tpookBr</p>
        <p> 4 tubts plus roctifitr; AC only</p>
        <p>Ff/co inthtkt fO^dcry warranty on parti and labor</p>
        <p>SPECIAL</p>
        <p>GENERAL ELECTRIC AUTOMATIC PORTABLE PHONOGRAPH</p>
        <p> Minn wp to 14 rocftfdw utomoticariy</p>
        <p> SktrR off BtftORioHcQtly</p>
        <p> Gonoroi itoctrk Dynopowor tpeaker</p>
        <p> P)rroxyiA-cooted fobrk covor</p>
        <p> W#H|hf only 1$ Ibi.</p>
        <p>Only</p>
        <p>Com# In today ,. </p>
        <p>59*</p>
        <p>Greenville TV &amp;amp; Appliance</p>
        <p>921 Dickinson Ave.. Greenville. N. C.  Phone  PL  2-2616</p>
        <p>MALCOLM WILLIAM6. Owner</p>
        <pb facs="00087514_0010" />
        <p>PAG TCn</p>
        <p>IHE UAILY REFLECTUR. UKEEnVILLE, N. C.</p>
        <p>Monday, December 5, 1960</p>
        <p>r</p>
        <p>In 1985 there were only 46 adult trumpeter wans in the United States. Now thanks to conservation, their numbers have grown to 1,500.</p>
        <p>OreenviUe. N. C.</p>
        <p>Dec. 5-12-19-26 Jan. 2-9</p>
        <p>Pubc Notices</p>
        <p>NOTICE TO CREDITORS</p>
        <p>NORTH CAROLINA</p>
        <p>rrrr county</p>
        <p>The undersigned, having qualified as Administratrix of the Estate of Matthew C. Sermorw deceased, late of Pitt County, this Is to notify all persons having claims against the said E.state to present them to the undersigned on or before the third day of December, 1961, or this notice will be pleaded In bar of their recovery. All persons Indebted to the said E.state will please make immediate payment to the undersigned in care of her Attorney.</p>
        <p>This the second day of December, I960.</p>
        <p>Jemima j. sermons</p>
        <p>Administratrix of the Estate of Matthew C. Sermons Rt. 1, Winterville, N. C. Bam B. Underwood Jr., Atty.</p>
        <p>NOTICE NORTH CAROLINA PITT COUNTY Having this day qualified as Administrator of the estate of Charlie Cooper, deceased, late of Pitt Cotipty, this is to notify all persons having claims against said estate to present them to the undersigned a Greenville, North Carolina, on or before the 3rd day of December, 1961, otherwise this notice will be plead in bar of their recovery. All persons Indebted to said estate will please make im-jmediate settlement.</p>
        <p>I This the 2nd day of December, !1960.</p>
        <p>i State Bank and Trust Co. Administrator of the Estate of Charlie Cooper, deceased Roberts At Stocks, Attys.</p>
        <p>Dec. 5-12-19-26 Jan. 2-9</p>
        <p>or this notice will be plead^ In bar of recovery. All persons Indebted to the estate Will please make immediate settlement.</p>
        <p>This the 1st day of December, 1960.</p>
        <p>H. R. SUTTON</p>
        <p>Administrator of the Estate of Richard Johnson Sutton Box 557, Greenville, N, C. Milton C. Williamson, Atty.</p>
        <p>Dec. 5-12-19-26 Jan. 2-9</p>
        <p>WUliam Wade O'Brien</p>
        <p>NOTICE or RESALE</p>
        <p>Pursuant to an Order of Resale signed by H. L. Lewis Jr., Assistant Clerk Superior Court of Pitt County, on November 22, 1960, Special Proceeding No. 6730, entitled:</p>
        <p>the undersigned will offer for resale and resell to the highest bidder for cash i3lefore the Courthouse door in Greenville, Pitt County, North Carolina, Saturday, December 10, 1960, at 12 oclock noon, all of the following tract or parcel of land and dwelling house located in the city of Greenville, North Carolina and more particularly described as follows;</p>
        <p>Courthouse door in Greenville, Pitt County, North Carolina, offer for saie to the highest bidder for CASH upcwj an opening Wd of $13.280, but subject to the confirmation of the Court, a certain tract of land in Swift Creek Township, Pitt County, North Carolina, more particularly de.scrlbed as follows:</p>
        <p>Wachovia Bank &amp;amp; Trust Company, Administrator for Ada Florence McCracken Hicks</p>
        <p>vs.</p>
        <p>NOTICE OF ADMINISTRAxifON</p>
        <p>Having this day qualified as Administrator of the estate of Richard Johnson Sutton, this Is to notify all persons having claims against the estate to file them with the undersigned within twelve months from the date of this notice</p>
        <p>Charles Thomas Hick.s and wife. Zelota Wameta Tripp Hicks; John ! Mac Hicks and wife, Eleander Elizabeth Whlchard Hicks; Gladys Hicks Marshall and husband, George C. Marshall; Louise Hicks Avery and husband, Butler Awery; Pauline Hicks Murray and husband. Ernest Allen Murray; Christine Hicks O'Brien and husband.</p>
        <p>Lying and being in the city of Greenville and beginning at iron stake at tSc intersection of Charles and Ninth Streets and running with the westeia boundary of Charles Street one hundred and fifty four feet to an iron stake at alley, thence a western direction with alley sixty feet to an iron stake, thence with the eastern line of Lot No. 21, one hundred and fifty four feet to an iron stake on Ninth Street, thence an easterly direction sixty feet to the BEGINNING, this being No. 20, as shown on Map of the division of lands of S. T. White made by W. C. Dresbach, February, 1913, said deed from Samuel T. White dated April 23, 1915 of record in Book C-11, page 152, of the Public Registry of Pitt County, reference to which is hereby directed for a more accurate and detailed description,. this having been the former residence of .the late Mrs. Ada Florence McCracken Hicks, widow of S. T. Hicks.</p>
        <p>BEGINNING at the point of Intersection of the center line of the main track of the Atlantic Coast Line Railroad with the cen-</p>
        <p>line of the main track of the Atlantic Coast Line Railroad with the center line of the j^ved road leading from Hanrahan, N. C. to Highway 11. and runs thence eastward-ly with the center line of the road 204 feet; thence it runs southwardly 504 feet to a scaxe m a ditch; thence it runs westwardly with the ditch 119 feet to a stake in the center of line of the main track of the Atlantic Coast Line .Railroad: thence it runs northwestwardly with the center of the main track of the railroad 491</p>
        <p>before the 23rd day of November, 1961, or this notice will be pleaded in bar of their recovery. All persona indebted to said estate will please make Immediate payment to said Administrate.</p>
        <p>This the 23rd day of November.</p>
        <p>I960.</p>
        <p>. COOPER E TAYLOR Administrator C.T. A. of the estgte of John R. Carroll, decised</p>
        <p>R. B. Lee, Atty,</p>
        <p>Nov. 28 Dec. 6-12-19-26 Jan. S</p>
        <p>ter line of the prfved road leading i feet to the point of the BEGIN-to N. G. Highway 11 from Hanra-i niNO. This farm has a 1960 ASC</p>
        <p>Tobacco Allotment of 4.16 acres.</p>
        <p>A ten per cent (10%) deposit will be required of the highest bidder, to be held open for ten days after the filing of the Report of Sale, as required by law 'This the 21st day of November. 1960.</p>
        <p>WILUAM C. BREWER JR.</p>
        <p>MARIONA. PARROTT Commissioners Attys.</p>
        <p>The terms of the public resale are cash, and the highest bidder iWill be required to make a deposit ;of ten (10%) per cent of his bid I at the resale. Resale will remain open for ten days for raised bid and confirmation.</p>
        <p>han, and runs thence eastwardly with the center line of the road 835.5 feet; thence it runs South 24-30 West 1172 feet to a stoke: thence it runs South 82-30 West 125 feet: thence it runs northwestwardly 175 feet to the center of the main track of the railroad; thence it runs North 38-15 West 474 feet to a stake; thence it runs North 13-40 East 469 feet to a stake; thence It runs North 50-44tjames &amp;amp; Speight, West 240 feet; thence It runsjMov; 28 Dec. 5 North 13-40 East 232 feet to a stake; thence it runs South 50-44 East 240 feet to a stake; thence it runs North 13-40 East 45 feet to a stake: thence It runs eastwardly 125 feet to a stake: thence It runs North 12-15 East 351.5 feet to the center line of the road; thence it runs South 64-10 East with the center line of the road 250.8 feet to the F&amp;gt;oint of the BEGINNING.</p>
        <p>Excepting therefrom the following tract of land: BEGINNING at the point of intersection of the center</p>
        <p>ADMINISTRATORS NOTICE TO CREDITORS</p>
        <p>Having qualified as Administrator C.T.A. of the estate of John R. Carroll, deceased, late of Pitt County, North Carolina, this is to notify all persons having claims against the estate of the deceased to exhibit the same, duly Itemized and verified, to Cooper E. Taylor. 3005 Banbury Road, Raleigh, North Carolina, or R. B. Lee, Attorney, Greenville, North Carolina, on or</p>
        <p>6-BOTTLE (ViRTON</p>
        <p>'This the 22nd day of November, 1960.</p>
        <p>DINK JAMES Commissioner James Ss Hite, Attys. Greenville. N. C.</p>
        <p>Nov. 28 Dec. 6</p>
        <p>NOTICE NORTH CAROLINA PITT COUNTY IN THE SUPERIOR COURT</p>
        <p>HARVEY W. MARCUS, ADMINISTRATOR c.t.a., d.bn. OF THE</p>
        <p>ESTATE OF HELEN M. HADDOCK. DECEASED vs.</p>
        <p>AGNES M. MUMPORD, WAVER-LY McLAWHORN AND WIFE. ROBERTA L. McLAWHORN, BLANCHE M. RIDER, ET AL</p>
        <p>Under and by virtue of an order of the Superior Court of Pitt County made in the Special Proceeding therein pending entitled as above, dated August 12, 1960, and signed by His Honor, D. T. House Jr., Clerk of the Superior Court of I'itt County; and under and by virtue of an order of resale upon an advance bid made and entered in this Court on the 21st day of November, 1960, the undersigned Commissicmer will on Friday, December 9. 1960, at* 12 ndon at the</p>
        <p>Champion Bourbon by Schenley</p>
        <p>straight Bourbon whiskey</p>
        <p>8 YEARS OLD</p>
        <p>^4.20 Vi</p>
        <p>2.75 pint</p>
        <p>5 quart</p>
        <p>8 YtAPS OLD-STRAIGHT BOURBON WHISKEV-86 PROOF-SCHENLEY OIST. CO.. N Y C.</p>
        <p>I</p>
        <pb facs="00087514_0011" />
        <p>December 8, 1980fHE DAILY REFLECTOR, CREENVILLE, N. C</p>
        <p>PAGE ELEVEN</p>
        <p>UOST  RENIT</p>
        <p>SELL.</p>
        <p>BUT</p>
        <p>MIRE* TR AD^</p>
        <p>IfDllU HN0 IT m 1IE MMNTMS!</p>
        <p>PUELIC NOTICE</p>
        <p>NOTICE TO CEEDITORS Having qalified as admtnis* tratrlces of the estate of Henry Edwards, this is to notify all per&amp;gt; ^ons having claims against the estate of the deceased to file the same, duly itemized and verified, with Geneva Edwards Page, Oreen-vine. North Carolina, RFD No. 3, or Carrie Edwards Paramore, Win-terviile, North Carolina, RPD No. I, on or before the I7th day of November, 1861, or this notice will be pleaded in bar of their recovery. All persons Indebted to aid estate will please make immediate payment to said administratrices.</p>
        <p>This the I7th day of November, I860.</p>
        <p>Geneva Edwards Page and Carrie Edwards Paramore. Administratrices of the State of Henry Edwards, dec'd B Lee, Atty.</p>
        <p>WANTED</p>
        <p>MroOLE -  AGED  WORKING</p>
        <p>woman to  share  apartment.</p>
        <p>Close in.  Good neighborhood.</p>
        <p>PL 2-2356. "  3-3t</p>
        <p>Nov. 21-28 Dec. 5-12-19-26</p>
        <p>WANTED Pecans! Pecana I ANNOUNCEMENT PECAN GROWERS</p>
        <p>Want to buy 50,000 lbs. of pecans. Small or large. Will pay top price. New Greenville Pruit Market, 710 Dickinson Ave. Located in front of John Collins Furniture Store. Sell with a man with 22 years experience. J. B. Creech, owner and manager.  Nov.  11-tf</p>
        <p>MONEY to LOAN</p>
        <p>QUICK LOANS.</p>
        <p>Need quick cash? Contact Security f.oan Corp., supervised by N. C. State Banking Conunission, 515 Dickinson Ave., Greenville. Phone PL 2-3660.  1-ft</p>
        <p>NOTICE OF SALE NORTH CAROLINA</p>
        <p>rirr county</p>
        <p>Under and by virtue of the power of sale ctmtalned in a certain* deed of trust executed by Sidney E. Mills and wife, Mary J. Mills, to R. Q. Wilmoth, Trustee, dated the 17th day of October, 1957, and recorded In Book Y-29, page 201, Wtt County RegUtry, default having been made in the payment of the Indebtedness thereby secure&amp;lt; and the said deed of trust belnr by the terms thmreof subject t foreclosure, and the holder of th* indebtedness thereby secured hav Ing demanded a foreclosure there-cf for the purpose of satisfying said Indebtedness, the undersigned Trustee will offer for sale at public auction to the highest bidder for cash at the Courthouse door in Greenville. North Carolina, at 12 oclock noon on the 22nd day of I'&amp;gt;ecember, I960, the lot or parcel of land conveyed in said deed of trust, the same lying and being in Greenville, I^tt County, North Carolina, and more particularly described as follows:</p>
        <p>Lying and being situate in the City of Greenville. Pitt County, North Carolina, and known and designated as all of Lot No. 40, Block A, Harrington-Williams 8ubdivlsion as the same appears on map of record in Map Book 6. page 141, Pitt County Registry There is aituate upon the above described premises a six and one-half room brick veneer dwelling.</p>
        <p>This sale will be subject to all ad valorem taxes or other assessments now due or which constitute -a lien cm the above described lot IIM parcl .^Had asflf^the highest Didder at wld sale will be required to deposit with said Trustee ten percent (10%) of the amount of his bid up to $1,000.00 and five percent (5%) on all In excess of $1 000 pending confirmation by the Court to .show his good faith. This 21st day of November, I960. R O WILMOTH Trustee I.. W. Gaylord Jr., Atty.</p>
        <p>Nov. 28 Dec. 5-12-19</p>
        <p>GOOD PLACES TO EAT</p>
        <p>Giva yoar wife a treat. Take her ovt^to eat, but be eve to take her to THE OLOE TOWNE INN on 5tk Si Yea wOl be glad you dUL Nov. 1-1 mo.</p>
        <p>i COKING  POR  SOMETHING</p>
        <p>good? Then try our delicious oarbecue,  steaks,  chicken and</p>
        <p>oyaters. We cater to parties; reserve our  private  dining room.</p>
        <p>Respess Bros. Barbecue. Bethel Highway. Phone PI 2-262*</p>
        <p>12 Nov. 1 mo,</p>
        <p>THERE OUGHT A BE A LAW!</p>
        <p>By FAGALY and SHORTEN</p>
        <p>WE CUEtOMEE vrfHOS THE BiGGlSTTHEBAT ID OUR REA90N IS THE OME WHO 8UVS AT THE t^GHTOf lUt SEASON -</p>
        <p>I HEN OUESS WHAT't RtTURNED tSTHf VfYf SAME OUN -WHtSi IT^ f AtlER SELllNO iARMU^Ff iN JLN</p>
        <p>{ iuT-BuT'ibuHApiT ^ AMONTHiWHATlu</p>
        <p>HELP WANTEDMALE</p>
        <p>WORK WANTED</p>
        <p>NEW ADDinONf, lag. rtpalrs of ah Kindi in gen*</p>
        <p>rtl carpentary work^^ wort</p>
        <p>guarantfid. Cah Pl JaokMS Jr.</p>
        <p>A.C July 9f7-tf</p>
        <p>I DO INVISIBLE- M9EAVING in clothing fabric, cOVer furniture and rugs. Also cpknitUng at my home, 218 Sylvania Ave Wintervllle. Phone PL 2-3668, Mrs. Robert Beddard.  l-6t</p>
        <p>HELP WANTED FEMALE</p>
        <p>Maids For New York Earn Cash Weekly $35-$60</p>
        <p>Free room, board, uniforms, TV. Guaranteed fobs in heart of New York City. Tickets sent at once. Dix Agency, 249 West 34th St., New York.  5-2t</p>
        <p>"WANTED FIRST CLASS painters. Rate $1.60 per hour. Apply Brewer Paint &amp;amp; Wallpaper Co., Inc. Rocky Mount, N C.</p>
        <p>2-4t</p>
        <p>SPECIAL NOTICES</p>
        <p>All Types of Plumbing Installed and Serviced Sam Pollard &amp;amp; Son Plumbing Company 202 E. 3rd Street Day FL 2-3661 Nite PL 2-4215 Dee. 1-1 mo.</p>
        <p>LET US PAINT YOUR CAR FOR Christmas in the new deep mirror finish. Special $50. Work guaranteed. Phone for appointment, Briley Paint Shop, PL 2* 2609.  29-6t</p>
        <p>FOR RENT</p>
        <p>aOOaiA APARTMBNT9,</p>
        <p>rooBiii and iwiaineai proper^ fm rent. Contact Orler Rental Agency Office located in Room 23. Rivera Buildini, N9 Evans Street, which Is npatalrs ever Chamber ot Commerce. Telephone PL 2-5700 Closed on Wednesday jiftemoona M</p>
        <p>PRIVATE UNFURNISHED Duplex apartment. 407 Pitt St. Steam heat, newly painted. Call PL 2-4437 freon 9 to 12 noon or after 5 p.m.  30-6t</p>
        <p>4 ROOM DUPLEX APARTMENT.</p>
        <p>dose to college and business (Lstrict. Newly painted inside. Dial PL 8-1246 day or PL 2-4273 night  2-6t</p>
        <p>rOR SALE</p>
        <p>TWO GIRLS 26 SECOND HAND bicycles. In good condition. Phone PL 2-2309.</p>
        <p>FOR SALE</p>
        <p>18 FT. KELVINATOR FREEZER for sale cheap. Call PL 2-4084 late afternoon or night. l-3t</p>
        <p>MONOGRAM OIL STOVE HAS been usee only 2 winters. Good as new. Also one water heater, gas. Mrs. J. Harvey Briley, 2301 E 3rd St Phone PL 2-5024.</p>
        <p>$-3t</p>
        <p>STARTER SET SALE ENDS DECEMBER 10th</p>
        <p>Franciscan 16 pc. starter set sale ends December 10th. Sixteen piece starter set in Apple, Ivy, Daisy, Autumn and Desert Rose on sale for $13.95. (Regular $17i)6).</p>
        <p>29-6t</p>
        <p>MAKE YOUR SELECTION EAR-ly. 1500 living Christmas Trees. $1.25 up. 5^ miles on Bethel Highway. Phone PL 2-6469, Mra. Pauline T. Whitehurst Nov. 11-lmo</p>
        <p>GARRIS SUPPLY FURNITURE and Appliances. 505 Dickinson Ave. Phont PL 2-5225. We buy. sell and trade new and used furniture and appliances.  54f</p>
        <p>MAIDSUVE-IN TO S220 MO, A-1 Jobs, Jargest. oldest N. Y. Agcy. Nicest homes. Tickets sent. Write Gem Agcy., 35 Lincoln, Ros-lyn Hts., N. Y.  5-lt</p>
        <p>NOTICE OF SERVICE OP PROCESS BY PUBLICATION NORTH CAROLINA PITT COUNTY IN THE SUPERIOR COURT BEFORE THE CLERK</p>
        <p>COMPANY, ADMINISTRATOR OF THE ESTATE OF OUSSU B. SmiOKLAND, DECEASED</p>
        <p>vs.</p>
        <p>JAMES ROBERT BULLOCK AND WIFE. HAZEL S. BULLOCK; MARY S. ELKS AND HUSBAND, IRVIN ELKS:  THOMAS  A.</p>
        <p>STRICKLAND AND WIPE, EMMA B. STRICKLAND; RALPH B. STRICKLAND AND WIFE, IRENE S. STRICKLAND; MARTHA 8. BULLOCK AND HUSBAND, BERNICE BULLOCK; JERRY G. STRICKLAND AND WIFE. JENNIE LOU S. STRICICLAND: CHARLES T. STRK3KLAND*AND WIPE, FAY H. STRICKLAND; FRANCES MARIE* (PEGGY) IANCASTER AND HUSBAND. GARLAND M. LANCASTER. AND ROBERT R. STRICKLAND (UNMARRIED)</p>
        <p>MAIDS. TO $60 WEEK Long Islands Top Agency</p>
        <p>has largest selection of better Joba,' fast service, gay, glamorous town. Free room, board, uniforms, TV. Tickets sent. Write today! A-1 Agency, 100 Main St., Hempstead, N. Y</p>
        <p>6-2t</p>
        <p>Turkey Shoot</p>
        <p>Every Saturday</p>
        <p>at</p>
        <p>1 p.m.</p>
        <p>*Til Christma*</p>
        <p>Behind Farmer^ Whse.</p>
        <p>l-9t</p>
        <p>ivXPERT SERVICE</p>
        <p>CALL RUD80N-TH0MA8 RADIO * TV Salea and Service fm guiek rtpaira Factory trmiaed iechnlclana and or.odem eoulB mest to etrvf you Day yhem PL t-768S. night PL 14185.</p>
        <p>aprfl I  M</p>
        <p>HOUSEWORKERS  NEW YORK Jobs-For better Jobs and bet</p>
        <p>ter aalarles write at once. Tickets</p>
        <p>sent. Reply givif|i name, address, of rei</p>
        <p>talephon o reference*. Dome Employment Agency, 153 East 116 St., New York.  5-lt</p>
        <p>$2.50 PER HOUR OR MORE FOR part or full time route work. Large repeat orders. Man or woman. Write McNESS CO., P. O. Box 371, Baltimore, Md. 5-lt</p>
        <p>TO; MARY 8. ELKS AND HUSBAND, IRVIN ELKS, RALPH B STRICKLAND AND WIFE. IRENE 8 STRICKLAND, AND MARTHA 8 BULLOCK AND HUSBAND, BERNICE BULLOCK;</p>
        <p>Each of you will take notice that a pleading aeeklng relief against you has l^n filed In the aboveentitled apeeial proceeding. The nature of the reUef being sought is at followi: Petitioner prays the Court that It, as administrator, be authorlaed and empowered to sell certain landi owned by Oussle B Strickland, deceased, and for the purpose of Creating aaaets with which to pay the debts due by the said Gussla B. Strickland, deceased.</p>
        <p>You are required to make defense to such pleading not later than December 23. 1960. and upon your failure to &amp;lt;io so the party seeking relief against you will npply to thrf Court for the relief sought.</p>
        <p>This 10th day of November, 1960.</p>
        <p>H. L. LEWIS JR.</p>
        <p>Ass't Clerk Superior Court Pitt County U-31-25 im. I</p>
        <p>Nov.</p>
        <p>loTaF sound</p>
        <p>ral 825x20 en N C. 11 between</p>
        <p>Oak City and Orenville Liberal rrward offered. North Side lumber Co., Greenville. Phon* PL 3-3181</p>
        <p>a-4t</p>
        <p>Wanted to buy</p>
        <p>WANT  BUY  -</p>
        <p>Oriental Rug. Dial</p>
        <p>A</p>
        <p>PL</p>
        <p>USED</p>
        <p>1-1333</p>
        <p>3-3t</p>
        <p>WANTED TO BUYt 1949 OR 1950 Ford, Chevrolet or Plymouth in vnnd condition. Call PL 2*5806. 5-8t</p>
        <p>Help Wanted Male-Female</p>
        <p>HELP WANTEDMALE</p>
        <p>AREA FIRM WITH NATIONAL reputation and attractive employee benefit plans desire skilled mechanical help. Openings to be filled in the following classificar tions: Production machine adjuster, machinist and clectlclan. Industrial exprience preferred. Mechanical or electrlal ability requir-ed. All replies kept confidential. Write qualifications and experience to "Maintenance Man, Box 408, Greenville, N. C.  5-5t</p>
        <p>DAILY REFLECTOR</p>
        <p>WANT AD</p>
        <p>INFORMATION</p>
        <p>Tout Want Ad Telephone Number is QretnvUle PLaaa 3-61M (11.00 minimum ehargt for 35 words or leas tor first interUon)</p>
        <p>3 Insertions .............. $  1.75</p>
        <p>3 inaertiona .............. $  3JK</p>
        <p> Inaertiona .............. $  876</p>
        <p>Ona Month  ........ $14.00</p>
        <p>DISPLAY WANT AOS ($1.35 per column inch per inaer-tlon)</p>
        <p>1 Week .................. I i-TS</p>
        <p>I Month .... ........... W3.00</p>
        <p>(Above rates for more than cmr msertlon apply to ads running on consecutive days.)</p>
        <p>DSADUNE No new ads, kills m corrections accepted alter 3, p.m. the day before publication.</p>
        <p>ERRORS-OM1S810NB nie Daily Reflectar will be respon* dhle only ter the first incorrect ot emitted Insertleii ef any advertisement in these solumns and then only to the extit ef a ntke-good inaertion. Brrora which do not legen the value of the advertisement will not] be corrected by a (nake-food insertion The publish-ar reserva* the right to revise or</p>
        <p>XOLL GET PROMPT, CARE-ful service for your car. Leave your car cares in our hands and well do only what has to be done. You can rely on us for complete car service. Carr Allens Texaco Station, next door to the post office. We give S &amp;amp; H Green Startips.  29-6t</p>
        <p>FRESH FEED MADE ON YOUR farm. Neutrcna Concentrate*. Regular schedule. No hauling, no waiting. Call Ayden MobUe Milling, Ayden PL 5911, Green</p>
        <p>ville PL 2-6270.</p>
        <p>1-ti</p>
        <p>SERVICE</p>
        <p>Capable FCC licensed technicians are always on hand to take care of unexpected radio and TV troubles.</p>
        <p>Phelps Radio &amp;amp; TV Service N. Greene Street PL 2-8827</p>
        <p>2-8t</p>
        <p>J. L. COX ROOFING it SHEET Metal, located at Bell Forks. Call GreenviUe PL 8-1870.  2-6t</p>
        <p>OIL BURNER SERVICE. YOUR car will burn less oil after our complete service. Ricks Service Center, corner 9th and Evans Streets.  29-6t</p>
        <p>RELIABLE RCXDFING COMPANY Anything In roofing, guttering, tinning, roof patching, sheet metal work. Will accept Jobs in towns around OreenvlUe 9br reliable service call Bobby Ray Lewis. PI 2-2452.  1101  MyrUe</p>
        <p>Ave., Greenville.</p>
        <p>Nov. 12-1 mo.</p>
        <p>TELEVISION "KNOW - HOW.</p>
        <p>Call us for your television, radio, and Hi-Fi repairs. All makes and models. Factory trained personnel: Appliance Mart, Inc., 320 Evans St. Day phone PL 2-5528 night phone PL 2-3921.  29-tf</p>
        <p>REAL ESTATI</p>
        <p>FOR SALE:  BRICK  VENEER</p>
        <p>house on 264 by-pass. Close to Colonial Heights. Owner leaving town. Call PL 2-5829.  3-3t</p>
        <p>MOVING?</p>
        <p>SAVE</p>
        <p>Local Si Long Distance Call Us For Estimates</p>
        <p>TARHEEL Truck Rentals</p>
        <p>HAMMOND ORGANS</p>
        <p>"For Church or Home Johnson Plano St Organ Co. Phone Collect JA 3-3584 KinstMi. N. C.</p>
        <p>Feb. 15-tf</p>
        <p>TW) ROOM FURNISHED apartment. Suitable for couple. Located 1308 Dickinson Ave. Call PL 8-1598.  3-tf</p>
        <p>SMALL HOUSE FOR RENT. CaU PL 2-4484.  3-tf</p>
        <p>ROU8B IN mill VILLAOS -Apply Carolina Orili July Ig-tf</p>
        <p>ONE DUPLEX APARTMENT IN Meadowbrook. Private fyontand back entrances. $35.00 per month. CaU PL 2^943 or PL 8-1108.</p>
        <p>3-6t</p>
        <p>TOOLS FOR RENT</p>
        <p>WE LOAN CARPET SHAMPOO er with purchase of Blue Lustre Shampoo. Belk Tylers 5-6t</p>
        <p>FARMS FOR RENT</p>
        <p>44 ACRES. 6 ACRES TOBACCO.</p>
        <p>4 cotton, balance com. Must own equipment. M. V . Jonas. FarmvlUe. N.C. Phona SK 3-3421.</p>
        <p>15-tf</p>
        <p>FARM FOR CASH RENT, 3.95 acres tobacco. Located Route 2, Ay^den, Coxville Cross Roads, Sally Cole.  5-5t</p>
        <p>Farm Equipment For Sale</p>
        <p>FOR  SALE! JOHN DEERE</p>
        <p>Oom Sheller and conveyor, Model 7. Like new. State Bank and iTust Co., Truat DeparUnent, Greenville, North Carolina</p>
        <p>2-6-7</p>
        <p>AUTOS FOR SALE</p>
        <p>FOR A DEMONSTRATION OF</p>
        <p>the aU new Lincoln, Mercury. Comet, and Rambler, and algo guaranteed used cars, call Clayton Gray, Wagner-Waldrop Motors, PL 2-4526. At night phone PL 2-5859.  Nov.  15-tf</p>
        <p>JUDYS SPECIALTY SHOP New Line of fall sportswear, sizes 7-14 and pre-teen. Also, Pre-Teen Party Dresses - - The HoUday Season, 4 styles of ladies robes, sizes 12-20. Colonial Heights Shopping Center. Nov. 4-lmo.</p>
        <p>STERLING FLATWARE  ALL patterns. Place your order now. Layaway for Christmas. Lautarcs Bro.., Greenville, N.C. Phone PL 2-3831.  Nov.  8-tl</p>
        <p>COLLIE PURE BREDSABLE and white  seven months old female. Beautiful, loves children. $35. Phone PL 8-1603.  30-St</p>
        <p>BARGAIN IN USED APPLI-anoes. Refrigerators, stoves, washers, dryers, gas, coal, and oil heaters, T. V. and water heaters. Roger Appliance Service, located at Park View Dr. Inn, Ayden. Phone PL 64271.</p>
        <p>Nov. 17-1 mo.</p>
        <p>CUSTOMERS SAY ROACH Pilmz is . the most effective roach control ever used. Ita invisible and Kmg lasting. Belk Tyler's  30-6t</p>
        <p>ELBCTROLUX</p>
        <p>Worlds only automatic vgcuum cleaner. Sales and service. Free home demonstration. J. M. Fleming Jr., Sales Representative, 305 ParU Ave. Dial PL 2-2287.</p>
        <p>Nov. 21-1 mo.</p>
        <p>USED TELEVISIONS. ALL makes and models in good condition. From $25 up. Also 25 foot Hotpolnt freezer. $l(X). Appliance Mart, Inc., 31K) Evana St. Phone PL 2-5528.  26-tf</p>
        <p>1957  4 DOOR BLACK 210</p>
        <p>Chevrolet, 8 cylinder. Automatic transmission, new tires, radio, heater, and defroster. Tinted windshield. liow mUeage. Call PL 2-3376.  30-tf</p>
        <p>FDU FRAME ALMINll aereens. aluminum and canvas awnings. Custom made to fit your windows at no extra oaat. Up to t ytara to pay For fret estimates</p>
        <p>eall CL. LaptOB Co., phone PL % 2235. OramiWe. N c. Apr 30-tf</p>
        <p>MEET TWO AUTOMOBILE salesmen who appreciate your business! T.G. Cayton and Paul Prevatte welcome the opportunity of serving you. CaU T.G. Or Paul at Jenkins Motor Co., PL 2-4636.</p>
        <p>Nov. 22-lmo.</p>
        <p>1957 FORD 9 PASSENGER country Squire. Green with wood paneling. Power features, many extras. Excellent condition. $1295. WiU assist financing and accept older car in trade. Telephone week days PL 2-7181, night PL 2-4723.  l-6t</p>
        <p>1959 CHEVROLET IMPALA. 4 door, power ateerlng and brakes. Turboglide, alr-condltioning, and many other extras. Low mileage. One owner. Reasonable price. Call PL 2-4938 after 6:30 p.m.</p>
        <p>29-6t</p>
        <p>FOR SALE</p>
        <p>FOR RENT</p>
        <p>6 ROOM DOWNSTAIRS APART-ment located at the comer of Broad and Lewi* Streets. Call Mrs. W.J. Lewis, PL 2-2346.30-lOt</p>
        <p>reject any copy SAVE</p>
        <p>,  ,  money</p>
        <p>(jrder your ad to run six timee; the cost la lew per day When you get desired results, call PL 2-6166 and stop the ad You pay for only the number of dayi your ad actually appeared</p>
        <p>4 ROOM DUPLEX APARTMENT With carport and heating plant. Ill Paris Ave. Phone PL 2-8737</p>
        <p>3-8t</p>
        <p>ONE UNFURNISHED UPSTAIRS</p>
        <p>' apartment located at East ITiird and Woodlawn. Convenient to college. Living room, kitchen and dinette, and two bedrooms. S35 per month. Call Glob* Htrd-Iware, PL 2-6175.  30-tf</p>
        <p>HOME HEA'HNO</p>
        <p>Complete air  conditioning and heating systems We make com plete installationa in new or exiat-Ing homes. Low monthly teniu with no down payment neceaaary GENERAL HEATING * AIR CONDITIONING X&amp;gt;.</p>
        <p>W. Sth St. Ext FHane PL 2-S81</p>
        <p>Feb. 1-tf</p>
        <p>Plant Bed Covers!</p>
        <p>Special sise 18 ft width. Cat any length. Ideal for treating plant beda and oold weather protection for plants later on.</p>
        <p>Hendrix-Barnhill Equipment Co,</p>
        <p>Nov. 29-tf</p>
        <p>/f</p>
        <p>SETTERS AND 1 GERMAN Shorthalr. Telephone PL 2-7978 or see Ronald Lassiter at Calico, Route 2. Box 513, Ayden 2-6t</p>
        <p>ONE FEMALE SIAMESE kitten for sale with papers. Mrs. H. M. Fisher, 612 W. Main Street. Phone Washington, N. C. WH 6-4855.  3-2t</p>
        <p>1951 PONTIAC. NEW PAINT.</p>
        <p>running condition  $100. Also brand new South Bend Futura spinning rod at less than wholesale price. Excellent Christmas gift. CaU PL2-5369.  S-3t</p>
        <p>Claasified Dbplay</p>
        <p>C. L. LUFTON CO.</p>
        <p>"Toar Comfort la Oar Bnilnaoi Fbono FL 8-tttl</p>
        <p>Awnings, aluminum or canvas storm windows and doors. Jalou-. alea and screeas. Venetian blinds re-corded and taped, porch tnclos-uree. points and hardware, roofing and siding .materials.  If</p>
        <p>WANTED</p>
        <p>GOOD, CLEAN COTTON RAGS</p>
        <p>Most be free of battons and lippen.</p>
        <p>Circulation Dept. Daily Reflector, Inc.</p>
        <p>BEST JEWELRY COMPANY</p>
        <p>5-lt</p>
        <p>Claaaified Diaplmf</p>
        <p>East Carolina Roofing Coaapaay Jobo Applied and FInmaeoi</p>
        <p>CLAUEE B. WEST, Mgr Gfflee  Proctor BMol Offico Phono PL 2-ll Bestdenc* Phono PL t-iSif</p>
        <p>FARMERS Radiator Service</p>
        <p>NOW OPEN</p>
        <p>An Kindt of Radiator Repalra and Reeoting</p>
        <p>Located 1000 Dickinson Ave. PL 2-5214</p>
        <p>Free Pickup St Delivery Servlee 25-Mon.. Wed,, Fri.-2 wka</p>
        <p>Santa's</p>
        <p>Gift</p>
        <p>Suggestions</p>
        <p>GIFTS  FOR THE ENTIRE f</p>
        <p>famUy. Featuring a complete line of Motorola radios, TV seta, stereos. FREE beautiful occasional chair with each TV purchase this week. Gammon Supply Co., Dickinson Ave. PL 2-4417.</p>
        <p>l-6t</p>
        <p>itt</p>
        <p>BOOKS</p>
        <p>Give a book this Christmas, the gift of lasting remembrance, and they cost much lesa to mail. ELLINGTONS BOOK STORE Evans St.  PL  t-1318</p>
        <p>l-6t</p>
        <p>Good Looking</p>
        <p>APPLIANCES! WESTINGHOUSE radios, electric fry pana.^'percu-.ators, mix - masters, Irons, oasters. waffle irons. Name brands. Corey Hardware, Colonial Heights Shopping Center, PL 2-6156.  1-et</p>
        <p>GIFTS FOR HER! ELECTRIC perculatora, fry pans, stew pans, can openers, knife sharpeners. aU kinds of kitchen ware. Pitt Hardware, Dickinson Ave. PL 2-3163.</p>
        <p>l-8t</p>
        <p>Christmas Cards. Gift WrappiAg Paper, Tree Lights and Decorations. Shop early for a better selection.</p>
        <p>BIGGS DRUG STORE</p>
        <p>Evans St.  PL 2-il36</p>
        <p>Nov. 24-1 mo.</p>
        <p>GI'-TS FOR THE SPORTSMAN!</p>
        <p>A new gun wiU make him happy, w&amp;lt;t carry a complete line of Remington, Winchester and Savage shotguns, gun cases and ammunition. H.L. Hodges Co., PL 2-4156.  26-6t</p>
        <p>A GIFT FOR GOLFERS! GOLF gloves, clubs, bags, shoes, balls, caddie carts, electric carts, umbrellas and aU accessories Harold Thomas, Pro. GreenviUe Golf and Country Club. PL 2-3412 or PL 2-3976.  Nov.  24-1 mo.</p>
        <p>In A Door Mirror Installed By Ut.</p>
        <p>All Kinds Of Glass Installed!</p>
        <p>Ernest &amp;amp; Knott Glass Co.</p>
        <p>Comer Dickinson Ave. St Clark St.</p>
        <p>FL 2-5582</p>
        <p>OreenvMle. N.C. Nov. 25-Dec. 5</p>
        <p>CHRISTMAS  DECORATIONS-</p>
        <p>Inside and outside. Poinsettlas, Centerpieces, Boxwood wreatha, cut flower*, mounted arrangements, candles, and beautiful tree light*. OrtenvUli Floral Co. PL 2-2827,  l-21t</p>
        <p>CHRISTMAS OPEN HOUSE Oar Chriatmaa Open House will take place Sunday, Dec. II. from I to 8 p.m. and Monday, Dec. it, from 9 a.m. to 9 pm. Christmas arrangement door prise.</p>
        <p>JOHNS FLOWERS</p>
        <p>l-t</p>
        <p>WATCHES FOR TEENAGERS!</p>
        <p>Standard hi-grade Swiss movements 17 Jewels. Guaranteed &amp;lt;me year. Lautares Bros., 414 Evans Street.  S-tf</p>
        <p>Gifts. For Her</p>
        <p>Brand New Modemage Sewing Machine 26 years Warranty</p>
        <p>$49.99</p>
        <p>Double Bed Single Control Electric Blanket Latest Decorator Colors 2 Year Warranty  Special at</p>
        <p>$14.95</p>
        <p>Sale of Lizagator Shoes and Bags</p>
        <p>Shoes a Bags **</p>
        <p>Lovely Lingerie With Boudoir Slippers to Match</p>
        <p>WE CARRY A COMPLETE LINE of tennis rackets, balls and shoes, volley balls, footballs gnd basketballs for the youngsters. See them now. H.L. Hodges Hardware, PL 2-4156.  3-8t</p>
        <p>COSTUME JEWELRY! ISEN-berg ' Ice, Napier, AUce Cavi-ness. Layaway now for Christmas. I.autares Bros., 414 Evans Street.</p>
        <p>3-tf</p>
        <p>We Can Do Your Construction</p>
        <p>or supply you with all the material if you do it yourself.</p>
        <p> Lumber</p>
        <p> Concrete</p>
        <p> Brick</p>
        <p> Roofing</p>
        <p> Hardware</p>
        <p>We will be glad to giva you free estimates.</p>
        <p>Dunn Building Supply Co., Inc.</p>
        <p>Memorial Dr. Tel. PL 8-3137</p>
        <p>This Christmas give a gift that will be treasured alwaysa gift from Best Jewelry Company where value, quality and integrity go hand-In-hand. You are invited to rislt Beats and see their wonder-jfui selection of gifts.</p>
        <p>CHRISTMAS SILVER SPECIALS FROM BESTS For glfta under $5.00 make your selection from English bon bons, Jam dishes, footed bon bons. card trays, napkin rings, ash trays, vases, tea bella, luggage tags, letter openers, pin cushions, whlskettes. bar acceasories, sterling flatware.</p>
        <p>All at . . .</p>
        <p>BELK-TYLERS</p>
        <p>Nov. 30-tf</p>
        <p>TOY8~USE OUR EASY LAY-away plan at Edwards Hardware, the house of finer play things. Make one stop for all your gifts.  l-6t</p>
        <p>ALL KINDS OP TROPICAL FISH and a complete line of tanks and food. Siamese and Persian kittens, Chihuahua puppies, harnesses, collars. Bill A Joes Pet Shop, PL 2-7238.  28-r</p>
        <p>For gift* from. $6.00 to $10.00 see the silver bread trays, open vegetable dishes, bowls, sandwich plates, bon bons, vases, round serving trajrs. gravy boats, candlesticks, console-compotes, butter dishes, butter platra, salt and pepper sets, celery trays, ice tongs, dreMlng spoons, English berry spoons, salad bowls, sterling flatware.</p>
        <p>Gifu For Him</p>
        <p>from</p>
        <p>BELK-TYLER</p>
        <p>$QM</p>
        <p>Mens Champ Hats  v</p>
        <p>IC.9</p>
        <p>Other Mens Bale Mens Style Sport Coate ONLY ^22'^</p>
        <p>7.99</p>
        <p>Archdale Tiae IJ.60 a IJAO</p>
        <p>Weycnberg Cordovan Loefers</p>
        <p>*17**</p>
        <p>Remington Rollamatte Electric Razors</p>
        <p>Nmr. M-tf</p>
        <p>For gifts from $10.00 to $15.00  vriTTR httnttnq and</p>
        <p>h .p.eUl</p>
        <p>coverKl  Md Hardwue. West Und</p>
        <p>trays, mest platters, well and tree  Men's and boys' huntins</p>
        <p>plattsrs, entoee dishes, pitchers, hostess platss. chip-an-dish dish-ss, pitchers, Revere bowls, covered casseroles, sterling flstware, vsses snd candlesticks.</p>
        <p>BEST JEWELRY COMPANY</p>
        <p>5-3t</p>
        <p>FOR YOUR PETS JOY AND comfort, visit Drums Hatchery for dog beds, sweaters, collars, harnesses, leashes, toys, food and tonici. Also bird houses, feeders snd wild bird food.  5-6t</p>
        <p>clothes, boots, shoes, socks, guns, ammunition and hunting licenses.</p>
        <p>Nov. 28-1 mo.</p>
        <p>GIFTS FOR EVERYONE! POUN-tain pens, portable typewriters, desk sets, globes, brief cases, ash trays, desk lamps, diaries, dictionaries, office accessories. Special, desk and chair set with Formica top, only $39.95. Taff Office Equipment Co. PL 2-2374.  29-22t</p>
        <p>Clastified Ditplay</p>
        <p>Special!! Farm Machinery</p>
        <p>Auction Sale</p>
        <p>Implementa, Tools, Miacellaneous Iteme</p>
        <p>Anyone Can Buy or Sell</p>
        <p>Pitt Co. Fair Grounds</p>
        <p> By-</p>
        <p>Greenville Liveatock Sales</p>
        <p>Phon* PL 2-BS14</p>
        <p>Friday, December 9th 10:00 A.M.</p>
        <p>Listing DeadUne Thnnday, Dee. , 6:50 P.M. Diimer Available On Oreunda For Farther Infonnatlon Contact;</p>
        <p>Gordon Dkkerson - PL  2-S98S</p>
        <p>Melvin Owens - PL  2-5919</p>
        <p>i-61</p>
        <p>Universal</p>
        <p>Coffeematics</p>
        <p>$19.98</p>
        <p>Dial Top ... the ealy Im-merslble with completa flavei election and reheat. Spmities model. Washes eempleltly under water or ia dlshwaahm. Chrome over solid eepper.  feet detachsble ord. Regular 124.55</p>
        <p>EDWARDS HARDWARE</p>
        <p> e </p>
        <pb facs="00087514_0012" />
        <p>PAGE TWELVETHE DAILY REFLECTOR, GREENVILLE, N. C</p>
        <p>Monday, December 8, 1960</p>
        <p>Stock And Market Reports</p>
        <p>RALEIGH (AP)(NCDA)Hof markets steady. Tops o 17.75 to 19.25 at Wson, 18.00 to 19.00 at Kinston, New Bern. Benson. Newton Grove, Mount Olive and Na-hunta; 18.25 to 18.75 at Rocky Mount; 17.75 to 18.75 at Smith-field and Dunn; 17.50 to 18.00 at Bethel and Murfreesboro; 18.25 at Albertson and Goldsboro; 18.00 at Greensboro, T a r b o r o, Enfield, Scotland Neck, Castle Hayne. Lil-lington and Rich Square; 17.50 at| Siler City.</p>
        <p>Wilson cash cattle prices steady: steers and heifers, choice 24 00 to 26.00, good 22.00 to 24.00, standards 18 00 to 22.00; cows, beef type 14.00 to 16.00, heavy cutters 12.00 to 14.00; bulls, light weights 11.00 to 15.00, heavyweights 15.00 to 17.00.</p>
        <p>The Dow Jonec Industrial average at noon wai off 1.66 at 5444.</p>
        <p>The components in the AP M stock average showed industries down .90, rails down .10 and utiU* ties unchanged.</p>
        <p>Corporate bonds were mixed in quiet trading.</p>
        <p>U.S. government bonds were unchanged to steady.</p>
        <p>Rural Dwelling Lost To Blaze</p>
        <p>New Orleans School Boycott Weakens A Bit More Today</p>
        <p>A farm house, located about a mile off the Old River Road, was destroyed by fire Saturday after-WALL STREET  noon. Ed Hemingway, chief of the</p>
        <p>NEW YORK (API  The liquid I Staton House Fire Department diet stocks showed renewed deported.</p>
        <p>strength in a slightly declining I The dwelling belonged to Susie stock market early this afternoon. I Langley, Negro. It was located on Trading was active.  Rt. 5, Greenville.</p>
        <p>The Associated Press average of Hemingway estimated the loss fW stocks at noon was down .40 toiat $4-$5,000 and he said it was</p>
        <p>9.70.</p>
        <p>JCey stocks dropped from fractions to about a point although most changes were small.</p>
        <p>Issues which caught traders</p>
        <p>partially covered by insurance. The blaze was discovered around 2 o'clock and the department was called around 2.30. the chief said. Since the fire was approximate-</p>
        <p>Funeral Tuesday For Mrs, Bryant Hardee</p>
        <p>imaginations due to prospects of ly 12 miles from the Staton House their entering the profitable liquid fire station, the department ar-diet field repeated their perform- rived too late to save the dwell-ance of last week and made solid'mg, according to Hemingway, upside progress  i He .said neighbors had saved</p>
        <p>Steels declined as another drop some clothing and beat out gra-ss In the steel industry operating fires started by the burning dwell-rate was anticipated. Autos werejing.</p>
        <p>Irregularly lower.  ' Hemingway reminded that the</p>
        <p>Building materials issues posted, scaton House Fire Department some plus signs- Aircrafts, chem* telephone number is PL 8-1827 Icais. oils and rubbers were most-'^nd the Stokes number is PL 2-ly*lower.____'6213. He said that these two num</p>
        <p>bers should be called for fires in</p>
        <p>Firemen Respond To Four Alarms</p>
        <p>Greenville firemen responded to four alarms over the weekend, three of which w'ere to hot heaters.</p>
        <p>Fire officers said they werf called to 212 West Fourth St. a*</p>
        <p>6:52 p.m. Saturday, and to 171 Spruce St. at 6:55 p.m. Saturday w'hen heaters at the two resi dences flooded and over-heated Fire units w'ere also sent to 11'</p>
        <p>West 11th St. Sunday when x heater there became too hot.</p>
        <p>Only minor damage was report ed at each address.</p>
        <p>Firefighters also reporfed r false alarm was turned in frorr Box 241 at the intersection o East and West Wright Road 1</p>
        <p>College Court Saturday at 9:3 p.m.</p>
        <p>The real name of Marshal Tito president of Yugoslavia, is Jcsf Broz.</p>
        <p>STATE</p>
        <p>TODAY, TES. A WED.</p>
        <p>FROM THE EARTH TO THE STARS...</p>
        <p>WITII RSCKCT MM WEDMNES 01) 8MIIN!</p>
        <p>NEW ORLEANS (AP)The boycott of an integnded elementary school weakened a IHt more today with 15 to 17 white papUs turning out lor Classes.</p>
        <p>They showed up at the William Frantz School where one Negro girl is enrolled in the first grade. The previous high white attendance. since the school was in-egrated by federal court order, was the 10 who went to classes Friday. There are 500 enrolted.</p>
        <p>Jeer* and taunts from women demonstrators greeted the white children and the Negro girl met a chorus of boos when she arrived.</p>
        <p>Youre as black as they are, shouted one wcmian at the white children.</p>
        <p>Nigger lover, yelled another. At McDonogh No. 19, the other .school integrated on Nov. 14, only the three Negro girls In the first grade entered the building today. Its enrollment was 500.</p>
        <p>However, police patrols at the .school were enlarged amid reports that white pupils would break the .McDonogh boycott today.</p>
        <p>The Louisiana Legislature gave quick approval Sunday to a bill providing state aid for pupils who prefer to attend private schools The legislature, despite a federal court order not to Interfere with the operation of New Orleans schools, is bent on preserving segregation.</p>
        <p>Moving quickly to meet the expected demand for schools.</p>
        <p>group as' he conducted services at two churches.</p>
        <p>Four women walked out of services conducted by the Rev. Lloyd A. Foreman at the Church of the Redeemer. One told an usher Hes a nigger lover.</p>
        <p>The minister conducted services later in the morning at St. Marks Methodist church. A man standing outside the building was led away by companions after he shouted, Ill challenge that louse, the rat,</p>
        <p>Foreman did not mention the school demonstrations in his sermons. At the evening service he prayed for guidance for state and city officials in these days of crisis</p>
        <p>In addition to providing an alternate school system the legls-</p>
        <p>Jo8. D. Wynne Sr. Funeral Held Today</p>
        <p>Mr. Joseph D. Wynne Sr., 60, died at his home ne&amp;amp;r Beargrass Saturday night at eight oclock.</p>
        <p>Funeral services were conducted at the Beargrass Presbyterian Church Monday afternoon at 3 oclock by the Rev. Charles Year-gan, a former pastor, assisted by Elder A. B. Ayers, Primitive Baptist minister of Beargrass. Burial was in the Woodlawm cemetery In Williamston.</p>
        <p>Mr. Wynne was a fanner and private I lived all his life in the Beargrass volunteer workmen] community, rushed repairs Sunday on a build-j surviving are his wife, Mrs. ing in suburban Arab! to be used ^ary Rogers Wynne; two sons, for some of the white students  ^ Wynne of Fayetteville</p>
        <p>boycotting the two schools.  ^ j wynne Jr. of near Bear-</p>
        <p>C. E, Vetter, businessman, said  ^</p>
        <p>so many workers showed up at</p>
        <p>iature approved resolutioiui designed to prevent banks from handing over school funds to the New Orleana School Board.</p>
        <p>the building that some had to be turned away. Registration at the private school was scheduled today and Tuesday. Classes were expected to start Wednesday,</p>
        <p>A Methodist minister who has</p>
        <p>grass; one daughter, Mrs. Fied A. Keel of Bethel: one grandchild; three brothers, William O. Wynne Jr. of the Beargrass community. Garland Wynne of the Crassroads community, and John L. Wynne of Everetts; three sisters. Mrs.</p>
        <p>ignored screaming, cursing white Farmer and Mrs pancille women to accompany his daugh- Jenkins, both of near Stokes, and ter. Pamela. 6. and other white | Mrs. Conii Cowan of near Wil-children to the Frantz School, was, liamston. jeered again Sunday by a small</p>
        <p>c 1 c , T J Bke* Today For Funeral Set Tuesday W. J. Manning</p>
        <p>For Possie Mills</p>
        <p>Mr. Possie Mills, 71, died at his</p>
        <p>BETHELMrs. Anna E. Jones Manning, 86. w'idow of William J.</p>
        <p>home near Black Jack Sunday Manning, died Sunday morning at night at 8:50 after having been the home of her daughter, Mrs.</p>
        <p>j Mrs. Didie Nelson Hardee, 98, ,died Sunday night at 10:45 after four years of illness.</p>
        <p>: ^She is survived by more ihan jlOO descendants.</p>
        <p>Funeral services will be conducted Tuesday afternoon at 2:30 In the Wilkerscm Funeral Chapel and burial will be in Greenwood Cemetery. Her pastor, the Rev. Alton Lancaster, will conduct the service, assisted by the Rev. Percy Upchurch. pastor of Memorial Baptist Church.</p>
        <p>Mrs. Hardee was a lifelong resident of the Greenville community and was the widow of Bryant H. Hardee. She was the oldest member of Salem Methodist Church and one of the oldest resident* of Pitt County.</p>
        <p>She is survived by two sons. Leon T. Hardee Sr. and Cleve F. ! Hardee, both of Greenville; a daughter, Mrs, J. Loiime Tucker of Simpson; a half-sister, Mrs. Lena C. Worthington of Ay den;</p>
        <p>27 grandchildren; 80 great grandchildren and a number oi great great grandchildren.</p>
        <p> helpful investment services</p>
        <p>APPRAISALS....QUOTATIONS....</p>
        <p>SECURITIES ANALYSIS.-...FRIENDLY GUIDANCE Coil our RepretentoHv* in this Areo</p>
        <p>Carolina Securities CorporcUion</p>
        <p>\})pes/net ^  '</p>
        <p>Members Midwest Stock ExcKonge CMAaLOTTI  RAIEIGH  NSW TORKCITV</p>
        <p>Jeto T. Gtoi. M,</p>
        <p>UM Leagmeadov</p>
        <p>Rd.</p>
        <p>Ureeavttle. N. 0. rhtrae</p>
        <p>PLasa' g-Mlt</p>
        <p>ladies! Oerae to CalSfbroia!</p>
        <p>A Greed Courvtry for</p>
        <p>MARRYING!</p>
        <p>200 huelNmd^Hieipy gidee aeeking a 6a*eforget-nag a pettobreefa^g ttotold dangent</p>
        <p>an Invalid for the past 15 years.</p>
        <p>Funeral services will be conducted at the Black Jack Free Will Baptist Church Tuesday afternoon at three oclock by the pastor, the Rev. Floyd Cherry, assisted by the Rev. D. E. Smith, pastor of the Black Jack Pentecostal Free Will Baptist Church. Burial w'ill be In Pinewood Memorial Park. The body will be taken from the home to the church one hour prior to the time of service.</p>
        <p>Mr. Mills spent all his life in the Black Jack community and was a member of the Black Jack Free Will Baptist Church, He was a farmer.</p>
        <p>Surviving are his w'ife, Mrs. Sophia Hardee Mills: five daughters, Mrs. Juanita Mills Hudson, Mrs. Chester Buck, of Black Jack, Miss Lizade Mills of the home, Mrs. Durwood Smith of Stokes-town, and Mrs. David C, Dixon of Greenville; four sons, Heber, Israel and Charlie Mills, all of Black Jack, and Albert Mills of Kinston; 14 grandchildren; four great grandchildren; cme brother, Harvey Mill* of the Chlcod School community: and a sister. Mrs. George Adams of WilliamstML</p>
        <p>John B. Robertson of Clayton. Funeral services were held at Bethel Methodist Church at 2:30 p.m Monday by the Rev. Carl Barbee, pastor, the Rev. T. N. Cooper, Baptist minister of Bethel, and the Rev. Wiley Clark, Pentecostal Holiness minister of Bethel. Burial was In Bethel Cemetery. Mrs. Manning w^as one of the oldest members of Bethel Methodist Church She was a member of the WSCS the Ea.stern Star and While Shrine. Surviving are two daughters. Mrs. Robertson of Clayton and Mrs. H. J. Stephens of Willow Springs; one son, X. E. Manning of Bethel; two sisters, Mrs. Lela Carson of Greenville and Mrs. Lucy M. Whitehurst of Bethel:  one brother, S. Lester</p>
        <p>Jones of Raleigh: 11 grandchildren; and 14 great grandchildren.</p>
        <p>Mrs. Manning as born in Pitt County, on June 5,  1874, the</p>
        <p>daughter of the late Robert M. and Fanny Sutton Jones.</p>
        <p>Grandsons of Mrs. Manning served as pallbearers.</p>
        <p>Predict Record Output After Brief Recession</p>
        <p>WASHUGTON (AP)National production ahould reach record levels next year despite higher unemployment and a brief recession early in the year, a U.S. Chamber of Commerce economist predicts.</p>
        <p>Dr. Emerson P. Schmidt, the chambers director of economic research, said the brief slowdown should bring a drop of 5 to 10 billion dollars in the annual production rate during the cutback.</p>
        <p>Schmidt made his predictions Sunday to a chamber business outlook conference despite cautiously optimistic reports from the auto, steel, banking and building industries.</p>
        <p>He said he expected a recovery in the second half of next year to send total output of goods and services to a record rate of $515 to $520 billion a year from now. For the first nine months of this year, the production rate was $503.5 billion a year.</p>
        <p>Peiping Accepb Guidance Of Moscow Leaders</p>
        <p>Commissioners...</p>
        <p>(Continued from Page One) for services. The remaining $148.52 was expenses.</p>
        <p>The board unanimously passed a resolution commending Wooten end Perkins for their services to the county. Perkins was commended for his services as chairman of the board.</p>
        <p>Wooten, stepping down today, declined to file for reelection as District Ill's representative and was succeeded by Strickland. He vas commended for his longtime service to the board.</p>
        <p>Upon request of the City of Greenville, Chairman Little appointed a nine-member panel to serve on the Greenville Planning and Zoning Commission. The nine njembers will be concerned with a one-mile strip outside the city limits is included in the citys authority.</p>
        <p>Appointed were T. T. Wagner, Hugh Winslow, Bob Starling. Carl Langley, Bob Kittrell, J. C. Parker. J. L. Page, Mrs. J. L. Little, end C. L. Edwards Little also appointed a committee, Perkins, Strickland, and Robert L. Martin, to recommend five men.oers to serve on the city'* Board of Adjustments. That committee is scheduled to submit Its icport at the boards January session.</p>
        <p>Committees</p>
        <p>As new chairman. Little appointed the following committees for 1961:</p>
        <p>FinanceLittle and Perkins; WelfareGardner and Strickland; Building and GroundsLittle and Perkins; Agriculture and Industry Martin and Strickland; Courts and Constitutional OfficesMartin and Gardner; Airport and Other PropertyLittle and Gardner; Education and Elections  Strickland; Hospital Board  Gardner and Martin; and Board of HealthLittle.</p>
        <p>MOSCXIW (AP)  Communist Chinas president today put a stamp of approval on Uie peaceful coexistence policy of the Sovi&amp;lt;^t Union as it apparently* has been ratified by the Communist summit conference which ended last week.</p>
        <p>In a goodbye speech at Leningrad. before continuing his tour of the Soviet Union, President Liu Shao Chi made a confessicm of faith in Soviet leadership.</p>
        <p>The great Soviet Union, he said, has always been and is today a powerful bastion of world peace. The initiative of the Soviet government and its proposals aimed at easing international disarmament and peaceful co-existence between countries with differing social systems have the sympathy and support of all peace-loving nations and peoples."</p>
        <p>He said further that the recent summit conference, resulted in a still further strengthening of the cohesion the entire* Communist movement and in a stiU further strengthening of the solidarity between the Communist party of China and the Communist party of the Soviet Union, between the Peoples Republic of China and the Soviet Union.</p>
        <p>(Mowcow radio broadcast Lius speech but this dispatch was delayed in passing through censors).</p>
        <p>Pravda, the Soviet Communist party newspaper, published a long editorial a week ago in which it stated that peaceful coexistence as interpreted by Premier Khrushchev is the correct interpretation.</p>
        <p>Coming as it did near the end of the conference, after more than two weeks of debate, it sounded as if the Soviets had laid down the law as they saw it.</p>
        <p>Thespeech by Liu Shao Chi was his way of saying that the man who pays the piper calls the tune. In his speech, he made It abundantly clear by pointing out that Chinas industrial and technical advances were heavily dependent on Soviet production.</p>
        <p>You manufacture for our country a great amount of intricate equipment, he said, make available to us a great amount of designing documentation, send us skilled specialists, train for our country a great number of technical specialists.</p>
        <p>All this is part of the tremendous assistance rendered by the Soviet government and the Soviet people to our countrys social construction.</p>
        <p>Rites Set For Mrs. Alice Etheridge</p>
        <p>Mrs. Alice Etheridge, 77. widow of Dr, Samuel Etheridge, died at the home of her daughter, Mr*'. Paul A. ToU In Greenville, Sunday mornitig.</p>
        <p>The body wa* aent to Sparks, Ga., where funeral services will be held at three oclock Tuesday a fternoQiL Burial will be in the 5-parks iPmetery.</p>
        <p>Mrs. Etheridge was a native of Georgia and had spent most of her life there. She had been a resident of Greenville for the past four months where she was a member of Jarvis Methodist Church.</p>
        <p>Surviving are a daughter; a son, R. F. Etheridge of Decatur, Ga.; and one grandson.</p>
        <p>Two Injuries Reported In Two Pitt Road Collisions</p>
        <p>Two injurie* were reported by highway patrolmen In two collisions investigated yesterday and today.</p>
        <p>Patrolmen Luther B. Long said Jessie WilUama of Route 5, Greenville reeeived lauerations of his right leg. and hand after a vehicle in which he was riding, wrecked on the Old Crebk tfload just north of Greenville about 12 45 a m. yesterday.</p>
        <p>A second Negro in the car. Johnnie Wilks. 32, address not given, was charged with public drunkenness - after being checked for injuries at Pitt Memorial Hospital.</p>
        <p>Long, who said investigation into the wreck is o)ntinulng, noted</p>
        <p>Father And Son Arrested On Liquor Counts</p>
        <p>Two Route l.-sivinterville Negroes, fatter a son. were arrested Saturday on charges of possession and tran^^xxtation of non-tax-paid whiskey for the purpose of sale after Pitt County ABC officers allegedly found a half-gallon of illegal spirits in their possesion.</p>
        <p>Officers identified the two as Isaac Junior Ellison, 27, and John Ellison, 53, both of Route 1, Wln-tcrville.</p>
        <p>Officers noted that young Ellison was also charged with carrying a concealed weapon after a .32 caliber automatic was allegedly found in the car, which was stopped near Venters Crossroads.</p>
        <p>Both'were released under $300 bonds for their* appearance in Coimty Court. The car, a 1952 model, is being held pending disposition of the case ^ court.</p>
        <p>Taking part in the arrests were ABC officers J. M. Ward, H. B. Lilley and Walter Taylor</p>
        <p>that the driver of the vehicle, which was teavily (Samaged, ha* not been Identfled. The officers said the driver reportedly left the scene of the acoidept before he arrived.</p>
        <p>David Raytte, 2 - year  edd Negro, wa* chargwi with opiating on the wrong side of the rijid following a wreck on the Shiver* Lane road just woit of Wlnier-vUle about 11:15 a m. today.</p>
        <p>Lcng, who * inveatigated the collision, said Payton apparently lost control of the truck on the sandy road, and ran into a ditch, causing an estimated $200 damage to the vehicle.</p>
        <p>A passenger in the truck, John Willoby, Negro of Winterville, received lacerations to hi* forehead and was treated at Pitt Memorial Hospital for ie injury and released, Long said.</p>
        <p>THEN GAVE UP</p>
        <p>PHILADELPHIA (AP)^Durlng the night burglar* tried to tunnel into the basement of a liquor store from the basement of an adjoining store. They had dug a, nice hole before they gave up  perhaps when they realized the liquor store has no basement-</p>
        <p>Meadowbrook</p>
        <p>ENDS TONIGHT Mttro-Gddwyn-Miyer'</p>
        <p>; SAMUEL GOLOWyN.Jgg</p>
        <p>mSySIsj</p>
        <p>THEmriiREs oFiiCiaBQlfiY</p>
        <p>Fwr.</p>
        <p>I CiMtwScM</p>
        <p>Colored News</p>
        <p>In Memoriam</p>
        <p>In memory of my dear wife, Elnora WUliams. whp departed this life, December 5, 1958, two years ago today at 4:45:</p>
        <p>It was such a shock to me, darling, I have not forgotten yet.</p>
        <p>I loved you so much, I will not ever forget you.</p>
        <p>I love you dear to my heart, but God loved you the best.</p>
        <p>So sleep on, darling, and take your rest.</p>
        <p>I hope some sweet day I will meet you in heaven.</p>
        <p>'WUlie WiUiams, husband</p>
        <p>Holiday Prices Gifts To You</p>
        <p>Edwards Hardware Features The Famous Universal Appliances At Bargain Prices.</p>
        <p>Mrs. Fannie Gorham has returned home after spending sometime in Newark, N. J.</p>
        <p>Mr*. Gorhams guest* for the weekend were Mr. and Mrs, Rubin Clark and Mr. and Mrs. Morris Sloan of Newark. N. J.</p>
        <p>In Memorlam In love and memory of my dear beloving husband, who passed away one year ago today:</p>
        <p>Theres an open gate at the eno of the road, through which each must go alone.</p>
        <p>And there in a light, we cannot see our Father claim His own. Beyond the gate our loved one finds happiness and rest.</p>
        <p>And there is comfort in the thought that a loving God knows best.</p>
        <p>Louis, we miss you so much.</p>
        <p>Mr*. Reatha Bell Taft</p>
        <p>The Sewing Circle will meet at the South Greenville Recreation Center Tuesday at 8 p.m. Anybne interested in participating Is Invited.</p>
        <p>SOUTH 11</p>
        <p>DRIVE-IN THEATRE</p>
        <p>oCup</p>
        <p>Six Of Amazing Pric# only</p>
        <p>$15.95</p>
        <p>Fomout ixclutive Features</p>
        <p>CHtOMI ON soiio coeeH</p>
        <p>yew cheote  necI fiaver ckaica. Coffaa taap* aniil tarva* evle-ot*co8y. Nan-drip H&amp;gt;ewt. foU wotar pump. HURIY ONLY A FEW AT</p>
        <p>Darcy Wall Type Electric</p>
        <p>CAN OPENER</p>
        <p>12.95</p>
        <p>Universal</p>
        <p>Steam &amp;amp; Dry Iron</p>
        <p>A steam and dry iron that challenges the performance etandards of the costliest irons offered anywhere.</p>
        <p>Regular</p>
        <p>$17.95</p>
        <p>9.95</p>
        <p>Moe CufitY</p>
        <p>Daxey</p>
        <p>ICE CRUSHER</p>
        <p>Regular $7.98</p>
        <p>5.95</p>
        <p>Universal</p>
        <p>HAND</p>
        <p>MIXER</p>
        <p>Super Special</p>
        <p>1^5</p>
        <p>Dasey</p>
        <p>NUT CRACKER</p>
        <p>Regular 87.98</p>
        <p>*5.95</p>
        <p>Complete Gift Selection of Housewares</p>
        <p> Pyrex Party Sets  O  Cutlery  Set*</p>
        <p> Libby Glassware  e  Cooking  Ware</p>
        <p>OPEN FRIDAY NIGHTS TIL 9 P.M.</p>
        <p>EDWARDS HARDWARE</p>
        <p>ALL APPLIANCES AT BARGAIN PRICES Etgtctctgtctgtctctctgtgtgteetjiif</p>
        <p>i</p>
        <p>TCOWIICOIOR* vLkT nVWSc MsYEnMSikassiteito-iMMtittsTiaiif</p>
        <p>Starts Thursday   # STATE</p>
        <p>EIGHT YEARS OLD</p>
        <p>STRAIGHT BOURBON</p>
        <p>$osq</p>
        <p>Eii</p>
        <p>STAGG OiSTiaiNG COMPANY. UWRENCESURG. INDIANA  86 PROOf</p>
      </div>
    </body>
  </text>
</TEI>